ID: 931645024

View in Genome Browser
Species Human (GRCh38)
Location 2:64414388-64414410
Sequence GATATAGGTTTCCAGCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931645024_931645034 28 Left 931645024 2:64414388-64414410 CCTGAGAGCTGGAAACCTATATC No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645024_931645025 -10 Left 931645024 2:64414388-64414410 CCTGAGAGCTGGAAACCTATATC No data
Right 931645025 2:64414401-64414423 AACCTATATCCCCTAAAAACAGG No data
931645024_931645032 24 Left 931645024 2:64414388-64414410 CCTGAGAGCTGGAAACCTATATC No data
Right 931645032 2:64414435-64414457 GATGCACTCTCTTAAGTTTAGGG No data
931645024_931645033 27 Left 931645024 2:64414388-64414410 CCTGAGAGCTGGAAACCTATATC No data
Right 931645033 2:64414438-64414460 GCACTCTCTTAAGTTTAGGGTGG No data
931645024_931645031 23 Left 931645024 2:64414388-64414410 CCTGAGAGCTGGAAACCTATATC No data
Right 931645031 2:64414434-64414456 TGATGCACTCTCTTAAGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931645024 Original CRISPR GATATAGGTTTCCAGCTCTC AGG (reversed) Intergenic