ID: 931645026

View in Genome Browser
Species Human (GRCh38)
Location 2:64414403-64414425
Sequence AGCCTGTTTTTAGGGGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931645026_931645031 8 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645031 2:64414434-64414456 TGATGCACTCTCTTAAGTTTAGG No data
931645026_931645034 13 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645026_931645033 12 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645033 2:64414438-64414460 GCACTCTCTTAAGTTTAGGGTGG No data
931645026_931645032 9 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645032 2:64414435-64414457 GATGCACTCTCTTAAGTTTAGGG No data
931645026_931645035 16 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645035 2:64414442-64414464 TCTCTTAAGTTTAGGGTGGGCGG No data
931645026_931645036 17 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645036 2:64414443-64414465 CTCTTAAGTTTAGGGTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931645026 Original CRISPR AGCCTGTTTTTAGGGGATAT AGG (reversed) Intergenic