ID: 931645027

View in Genome Browser
Species Human (GRCh38)
Location 2:64414410-64414432
Sequence GGTTGCTAGCCTGTTTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931645027_931645031 1 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645031 2:64414434-64414456 TGATGCACTCTCTTAAGTTTAGG No data
931645027_931645036 10 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645036 2:64414443-64414465 CTCTTAAGTTTAGGGTGGGCGGG No data
931645027_931645035 9 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645035 2:64414442-64414464 TCTCTTAAGTTTAGGGTGGGCGG No data
931645027_931645033 5 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645033 2:64414438-64414460 GCACTCTCTTAAGTTTAGGGTGG No data
931645027_931645032 2 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645032 2:64414435-64414457 GATGCACTCTCTTAAGTTTAGGG No data
931645027_931645034 6 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931645027 Original CRISPR GGTTGCTAGCCTGTTTTTAG GGG (reversed) Intergenic