ID: 931645028

View in Genome Browser
Species Human (GRCh38)
Location 2:64414411-64414433
Sequence TGGTTGCTAGCCTGTTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931645028_931645032 1 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645032 2:64414435-64414457 GATGCACTCTCTTAAGTTTAGGG No data
931645028_931645037 30 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645037 2:64414464-64414486 GGCACTAGTTTATGTTTAACTGG No data
931645028_931645033 4 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645033 2:64414438-64414460 GCACTCTCTTAAGTTTAGGGTGG No data
931645028_931645035 8 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645035 2:64414442-64414464 TCTCTTAAGTTTAGGGTGGGCGG No data
931645028_931645036 9 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645036 2:64414443-64414465 CTCTTAAGTTTAGGGTGGGCGGG No data
931645028_931645031 0 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645031 2:64414434-64414456 TGATGCACTCTCTTAAGTTTAGG No data
931645028_931645034 5 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931645028 Original CRISPR TGGTTGCTAGCCTGTTTTTA GGG (reversed) Intergenic