ID: 931645029

View in Genome Browser
Species Human (GRCh38)
Location 2:64414412-64414434
Sequence ATGGTTGCTAGCCTGTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931645029_931645033 3 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645033 2:64414438-64414460 GCACTCTCTTAAGTTTAGGGTGG No data
931645029_931645032 0 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645032 2:64414435-64414457 GATGCACTCTCTTAAGTTTAGGG No data
931645029_931645034 4 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645029_931645031 -1 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645031 2:64414434-64414456 TGATGCACTCTCTTAAGTTTAGG No data
931645029_931645036 8 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645036 2:64414443-64414465 CTCTTAAGTTTAGGGTGGGCGGG No data
931645029_931645037 29 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645037 2:64414464-64414486 GGCACTAGTTTATGTTTAACTGG No data
931645029_931645035 7 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645035 2:64414442-64414464 TCTCTTAAGTTTAGGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931645029 Original CRISPR ATGGTTGCTAGCCTGTTTTT AGG (reversed) Intergenic