ID: 931645034

View in Genome Browser
Species Human (GRCh38)
Location 2:64414439-64414461
Sequence CACTCTCTTAAGTTTAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931645026_931645034 13 Left 931645026 2:64414403-64414425 CCTATATCCCCTAAAAACAGGCT No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645024_931645034 28 Left 931645024 2:64414388-64414410 CCTGAGAGCTGGAAACCTATATC No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645028_931645034 5 Left 931645028 2:64414411-64414433 CCCTAAAAACAGGCTAGCAACCA No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645029_931645034 4 Left 931645029 2:64414412-64414434 CCTAAAAACAGGCTAGCAACCAT No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645027_931645034 6 Left 931645027 2:64414410-64414432 CCCCTAAAAACAGGCTAGCAACC No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data
931645023_931645034 29 Left 931645023 2:64414387-64414409 CCCTGAGAGCTGGAAACCTATAT No data
Right 931645034 2:64414439-64414461 CACTCTCTTAAGTTTAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931645034 Original CRISPR CACTCTCTTAAGTTTAGGGT GGG Intergenic
No off target data available for this crispr