ID: 931648720

View in Genome Browser
Species Human (GRCh38)
Location 2:64449709-64449731
Sequence CAGTATCTGCATCATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931648720_931648723 19 Left 931648720 2:64449709-64449731 CCCTCTTCATGATGCAGATACTG No data
Right 931648723 2:64449751-64449773 ATATACATTTCTTTTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931648720 Original CRISPR CAGTATCTGCATCATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr