ID: 931649361

View in Genome Browser
Species Human (GRCh38)
Location 2:64454363-64454385
Sequence CCTGGCAGGCAGAGCCTGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 798
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 706}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931649361_931649369 -6 Left 931649361 2:64454363-64454385 CCTCCCAGGCTCTGCCTGCCAGG 0: 1
1: 0
2: 4
3: 87
4: 706
Right 931649369 2:64454380-64454402 GCCAGGTCGGCGCCGGGCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 318
931649361_931649371 -5 Left 931649361 2:64454363-64454385 CCTCCCAGGCTCTGCCTGCCAGG 0: 1
1: 0
2: 4
3: 87
4: 706
Right 931649371 2:64454381-64454403 CCAGGTCGGCGCCGGGCCCCGGG 0: 1
1: 0
2: 1
3: 30
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931649361 Original CRISPR CCTGGCAGGCAGAGCCTGGG AGG (reversed) Exonic
900087092 1:903959-903981 CCCAGCAGGCCGAGCCCGGGTGG + Intergenic
900173819 1:1283316-1283338 CCTGGCTGACAGACACTGGGTGG - Intronic
900270231 1:1783201-1783223 CCTGGCTGGCAGTTCCTGGGAGG - Intergenic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900531735 1:3157130-3157152 CCTGCCGGGCTCAGCCTGGGCGG + Intronic
900589561 1:3453671-3453693 CCAGGGAGGCAGGTCCTGGGAGG + Intergenic
900606783 1:3527294-3527316 GGTGGCAGGCACAGCCTGGTGGG - Intronic
901207259 1:7504209-7504231 CCTGGGCAGCAGAGCCTGGCAGG - Intronic
901244611 1:7719873-7719895 CCTGGCAGGGAGAGCTGAGGAGG - Intronic
901362403 1:8713656-8713678 CCCGGGAGGCAGAGCCTGTAGGG + Intronic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901506139 1:9687363-9687385 ACGGGCAGACAGAGGCTGGGAGG - Intronic
901718439 1:11175724-11175746 CCTGCTAGGGAGAGCCTGAGAGG - Intronic
901792688 1:11662584-11662606 ACCAGGAGGCAGAGCCTGGGTGG - Exonic
902270559 1:15301438-15301460 CCAGGTAGGCAGAGCCTGAGAGG + Exonic
902648230 1:17819050-17819072 CCTGGGAGGAGGAGGCTGGGAGG - Intronic
902762409 1:18591181-18591203 CTTGGTAGGCTGAGCCTGGGAGG - Intergenic
902783738 1:18720153-18720175 GCAGGCACGCAGAGCCTTGGAGG - Intronic
902975322 1:20084257-20084279 CTTTGCAGGCAGAGGCTGGGCGG - Intronic
903009587 1:20320332-20320354 CTAGGCGGGCAGAGCATGGGTGG - Intronic
903013763 1:20348677-20348699 CCTGGCAGTTGGTGCCTGGGAGG - Intronic
903342184 1:22661406-22661428 GCTGGCAGGGGGAGCCGGGGTGG - Exonic
903486341 1:23691876-23691898 CATGGCAGGCCGAGCCTGCGGGG + Intronic
903957480 1:27035330-27035352 CCAGACACGCAGAGACTGGGAGG - Intergenic
904044892 1:27603186-27603208 CCTGGCAGGCAGCGCCGGGAAGG - Intronic
904436713 1:30503669-30503691 GCTGGGAGGCAGGGCCTTGGAGG + Intergenic
905108017 1:35575427-35575449 CCTTCCAGGCAGGGCCTTGGAGG + Intronic
905337837 1:37257658-37257680 CCAGACAGGCACAGGCTGGGTGG - Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907160932 1:52368518-52368540 GCTGGCAGGCAGGGCCTCGCTGG - Intergenic
907246286 1:53111148-53111170 ACAGAGAGGCAGAGCCTGGGAGG + Intronic
907304080 1:53504223-53504245 TCTGGGAGGCAGAGGCTGAGAGG + Intergenic
908697262 1:66857608-66857630 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
908780358 1:67685205-67685227 GCTGGTAGGCAGTGGCTGGGAGG + Exonic
908861183 1:68491855-68491877 CTTGGGAGGCCGAGCCCGGGAGG - Intronic
909024639 1:70468247-70468269 CATTGCAGTCAGAGCCTTGGTGG + Intergenic
910678500 1:89839373-89839395 CCAGGCAGGTAGGGCCAGGGTGG - Intronic
911569628 1:99507657-99507679 CTTGGCAGGCCGAGGCAGGGAGG - Intergenic
912496545 1:110095417-110095439 TCTGGGAGACAGTGCCTGGGTGG + Intergenic
914696182 1:150082428-150082450 CCTGGGAGGCGGAGGTTGGGAGG + Intronic
914964413 1:152241353-152241375 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
915318017 1:155040634-155040656 CTGCACAGGCAGAGCCTGGGGGG + Intronic
915438897 1:155931484-155931506 CTTGGGAGGCTGAGCCTGGGAGG + Intronic
915913325 1:159927658-159927680 CCTGGGAGGCAGGGCCTGACTGG + Intronic
916408572 1:164522238-164522260 TCTGGCAGGGACAGCCTGTGAGG - Intergenic
917615818 1:176743129-176743151 CCTGGCAGCCAGAATCTGTGAGG + Intronic
917637998 1:176955738-176955760 TCTGACAGGCAGACCCTGAGGGG + Intronic
918038637 1:180898672-180898694 CGTGGCAGACAGAGCCTGAGAGG + Intergenic
919221643 1:194638277-194638299 CCTGGAAGGCGGAGGGTGGGAGG - Intergenic
919568459 1:199218494-199218516 CATTGCAGACAGAGCCTTGGTGG - Intergenic
920007574 1:202844688-202844710 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
920032130 1:203043909-203043931 GCTGGCAGGGAGAGCAGGGGAGG - Intronic
920208540 1:204311413-204311435 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
920649710 1:207827654-207827676 CCCAGCAGGCAGAGCCAGGAGGG - Intergenic
920915360 1:210254074-210254096 CCTGGCAGCCATAACCTAGGTGG + Intergenic
920989411 1:210922304-210922326 CCTGGGAGGCAGAGCTTGCATGG + Intronic
921032988 1:211350322-211350344 CCTGGGAGGCTGAGGCAGGGGGG - Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921260605 1:213382571-213382593 CTTGGCAGGCGTGGCCTGGGTGG + Intergenic
922239249 1:223744783-223744805 CCTGGGAGGCAGAGGTTGGGAGG + Intronic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
923106861 1:230861048-230861070 AGTGGCTGCCAGAGCCTGGGGGG + Intronic
923263346 1:232288476-232288498 CTTGCCAGACAGAGCTTGGGTGG - Intergenic
923616870 1:235545442-235545464 CAGGGCAGGCAGGGCCTTGGAGG + Intergenic
923676977 1:236088628-236088650 CCTGGCATCCAGAGCCTGGGTGG + Intergenic
923727902 1:236523529-236523551 CCAGGCAGGCGGGGCCTGTGCGG + Exonic
924940372 1:248809177-248809199 ACTGGCAGGCAGGACCTGTGAGG - Intergenic
1062841657 10:678046-678068 CCTGGAGGGCAGTGCCTTGGTGG - Intronic
1062972810 10:1661596-1661618 CCAGGGAAGCAGAGCCAGGGTGG + Intronic
1063819695 10:9819967-9819989 CCATGCAGTCAGAGCCTTGGTGG + Intergenic
1063970802 10:11380046-11380068 CCTGGCAGGAGCAGCTTGGGGGG + Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066349229 10:34621438-34621460 CTTGGGAGGCCGAGCGTGGGTGG - Intronic
1066559885 10:36658686-36658708 CCTGGGAGGCAGAGGTTGCGGGG + Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066685361 10:37976466-37976488 GCGGGCGGGCAGGGCCTGGGAGG - Intronic
1067044143 10:42975046-42975068 CCTGGCAGGCAGCCCCAGCGGGG - Intergenic
1067083081 10:43222557-43222579 CCTGGAGTGCAGTGCCTGGGAGG + Intronic
1067582713 10:47455744-47455766 CAAGGCAGGAAGACCCTGGGGGG + Intergenic
1068427921 10:56891740-56891762 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1069545612 10:69325908-69325930 CCTGGCAGGCAGAGGTTGCAGGG - Intronic
1069586124 10:69603785-69603807 CCTGGGAGGCTGAGATTGGGAGG + Intergenic
1070356701 10:75647100-75647122 TCTGGCAGCAAGAGCCGGGGAGG - Intronic
1070893665 10:79963233-79963255 CTTGGCAGGCTGAATCTGGGAGG + Intronic
1071086571 10:81874352-81874374 CCTGGCAGCCAGAGCCCGTCTGG + Intergenic
1071336134 10:84601698-84601720 CCTGGCAGGCAGCGCCTCCCGGG - Intergenic
1072294249 10:93994066-93994088 CCCGGGAGGCAGAGCCCGGGAGG - Intronic
1072294254 10:93994080-93994102 CCCGAGAGGCAGAGCCCGGGAGG - Intronic
1072690924 10:97571975-97571997 CCTGACAGGGAAACCCTGGGAGG + Intergenic
1072714918 10:97744619-97744641 CCTGACTGGCAGAGCCCTGGAGG + Intronic
1073059557 10:100725107-100725129 CTTGACAGGAAGAGCCAGGGAGG + Intergenic
1073527419 10:104197615-104197637 CCTGGCTTGCAGAGCTTGGGTGG + Intronic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1075768043 10:124910178-124910200 CCCAGGAGGCTGAGCCTGGGAGG + Intergenic
1076374163 10:129972583-129972605 CCTGGCGAGCACTGCCTGGGAGG - Intergenic
1076653919 10:132008621-132008643 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1076729630 10:132431943-132431965 CCCAGCAGGGATAGCCTGGGGGG + Intergenic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076921273 10:133455916-133455938 CTTGGGAGGCAGAGAGTGGGTGG + Intergenic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077034881 11:489788-489810 GCTGGGGAGCAGAGCCTGGGAGG + Intronic
1077108458 11:851823-851845 GCAGGCAGGCAGGTCCTGGGAGG + Intronic
1077153675 11:1082206-1082228 CCTGGCTGGCAGCCCCTCGGTGG + Intergenic
1077186390 11:1237178-1237200 CTTGGCAGGCAGGGTCTGGTGGG + Intronic
1077376958 11:2209619-2209641 CCTGGGAAGCAGGGCCAGGGTGG - Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077404146 11:2375317-2375339 CCAGCTAGGCAGAGCCGGGGAGG - Intergenic
1077557029 11:3230800-3230822 CCGGGAAGGCAGACCATGGGTGG + Intronic
1077648973 11:3952303-3952325 TTTGGGAGGCTGAGCCTGGGAGG + Intronic
1078024859 11:7685224-7685246 CCTGGTAGGCACAGAATGGGAGG + Intergenic
1078125295 11:8555587-8555609 TCTGGGAGGCAGAGCTTGTGGGG + Intronic
1078648119 11:13161167-13161189 CCTGGAAAGAAGAGTCTGGGTGG - Intergenic
1078710563 11:13786928-13786950 CCTGACAGGAAGAGCCTGACAGG + Intergenic
1078740979 11:14065980-14066002 GTTGGCAGGGAGAGCCAGGGAGG + Intronic
1078846443 11:15123007-15123029 TGTGGCAGGGAGAGCCAGGGAGG - Intronic
1078857617 11:15219529-15219551 CCTGGCAGCCAGGCCTTGGGTGG + Intronic
1078901963 11:15650355-15650377 CCCGGGAGGCAGCGCCTGGATGG + Intergenic
1078936221 11:15952652-15952674 CCTACCAGGCAGAGACTGGAAGG + Intergenic
1079082438 11:17423279-17423301 CCTAGGAGGCAGAGCTTGTGAGG + Intronic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1081772147 11:45656725-45656747 GCTGGCTGGCAGTGCCTGGGGGG - Intronic
1081809822 11:45908507-45908529 CCTGGCAGGGCAAGCCTTGGTGG - Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1083330772 11:61897454-61897476 CCTGGCATGTGGGGCCTGGGTGG - Exonic
1083945374 11:65920098-65920120 TGAGGAAGGCAGAGCCTGGGTGG + Intronic
1084449951 11:69230786-69230808 CCTGGCCCTCAGAACCTGGGAGG - Intergenic
1084651394 11:70491409-70491431 ACCGGCAGGCAGGGCCTGGAGGG + Intronic
1084937421 11:72594596-72594618 CCTGGCAGCCAGAGCCCAGCTGG + Intronic
1085311276 11:75518314-75518336 CCAGGCAGGAAGGTCCTGGGGGG + Intronic
1085445310 11:76597426-76597448 CTGGGCAGGGAGGGCCTGGGAGG - Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087606566 11:100384502-100384524 CCTGGAATGAAGTGCCTGGGGGG + Intergenic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1089064758 11:115654085-115654107 CCTGGGCGGCCGAGGCTGGGTGG - Intergenic
1089737158 11:120557354-120557376 CAGGGCAGGCACAGCCTGTGAGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090106134 11:123854992-123855014 CCTGGCAGGGAGTTCCTGGTAGG + Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091099582 11:132858409-132858431 TCTTGCAGGCAGAGCAAGGGAGG - Intronic
1091122277 11:133066115-133066137 CTTGGCAGGCAGAGGCGGGCAGG - Intronic
1091224105 11:133947266-133947288 ACTGCCAGGCAGGGCCAGGGAGG + Intronic
1091311505 11:134578201-134578223 CTTGGCAGGCAGGGGATGGGGGG + Intergenic
1091602193 12:1924689-1924711 CCAGGCAGGCAGCCGCTGGGAGG + Intergenic
1092145960 12:6214858-6214880 TCACGCAGGCAGGGCCTGGGTGG + Intronic
1092242163 12:6841641-6841663 CCCGGAAGGCAGGGCATGGGGGG + Intronic
1092249414 12:6884301-6884323 CTTGGCCTGCAGGGCCTGGGTGG - Intronic
1092386554 12:8039921-8039943 CCCGGGAGGCCCAGCCTGGGAGG - Exonic
1092496816 12:9004578-9004600 CTTGGGAGGCAGAGGCAGGGAGG - Intronic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1094820576 12:34221000-34221022 CTTGGGAGGCTGAGCCTGGAGGG - Intergenic
1095307078 12:40651279-40651301 CAAGCCAGGCACAGCCTGGGTGG - Intergenic
1095311455 12:40702518-40702540 CCTGGGAGGCAGAGGTTGCGGGG - Intronic
1095777184 12:46023381-46023403 CCTGGCAGGGGGAGCTGGGGTGG - Intergenic
1095930529 12:47620693-47620715 CAGAGCGGGCAGAGCCTGGGGGG + Intergenic
1096573362 12:52537597-52537619 CCTGGTGGGCACAGCTTGGGTGG - Intergenic
1096976179 12:55700379-55700401 CCTTGCAGGCACGGCCAGGGTGG - Exonic
1097042439 12:56163851-56163873 CATGGCATGCAGTGGCTGGGTGG + Intronic
1100311433 12:93398262-93398284 CCTGGGAGGCAGAGATTGTGGGG + Intronic
1100836467 12:98571474-98571496 CCTGGGAGGCAGAGGCTGTGTGG - Intergenic
1101120958 12:101579690-101579712 CCTGGGAGGCAGAGGTTGTGGGG - Intronic
1101745528 12:107538643-107538665 CCAAGCAGGAAGAGCCTGGAGGG - Intronic
1101813740 12:108129741-108129763 CCCGGCAGGAGGAGCCTTGGTGG + Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102229333 12:111251743-111251765 CCCCTCAGCCAGAGCCTGGGTGG + Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1103606057 12:122086993-122087015 CCTGGCAGGCTCAAGCTGGGCGG - Intronic
1103609493 12:122114061-122114083 CCTGGGAGGCAGAGGTTGCGCGG - Intronic
1103627855 12:122234365-122234387 CCCAGGAGGCTGAGCCTGGGAGG - Intronic
1103666067 12:122566849-122566871 CTTGGGTGGCAGAGCTTGGGAGG - Intronic
1103738375 12:123075391-123075413 CCTGCCCAGCACAGCCTGGGTGG + Intronic
1104806426 12:131592234-131592256 CAGGGCTGGCAGAGCCCGGGAGG - Intergenic
1104892637 12:132147825-132147847 CCAGGGAGGCAGGGACTGGGGGG + Intronic
1104953456 12:132452835-132452857 CCTGGCAGTCAGAGCTGGGAGGG - Intergenic
1105426002 13:20295699-20295721 CCCGGCAGGGACATCCTGGGGGG + Intergenic
1105435565 13:20375024-20375046 CATGACAAGCAGAGCCAGGGAGG + Intergenic
1105745803 13:23375757-23375779 CCTGGCAGGCGGAGCCTGGTGGG - Intronic
1106314774 13:28583724-28583746 CCAGGAAGGCAGAGGCTGAGAGG + Intergenic
1106489987 13:30212488-30212510 CCTGGCAGGCTGAGCTCGGCTGG - Intronic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1109505985 13:63304190-63304212 TCTGGGAGGCAGAGGCGGGGTGG - Intergenic
1111487669 13:88926081-88926103 CCTGGCAGGCTGTGCTTGGCTGG + Intergenic
1112463815 13:99625798-99625820 CCTGGGACTCAGAGCCTGGGAGG - Intronic
1113106279 13:106775054-106775076 CCTGGGAGGAAGAGAGTGGGAGG - Intergenic
1113489629 13:110680922-110680944 GCTGGCAGGCAGGGCCCGGGAGG + Intronic
1113930650 13:113967258-113967280 CCTGGCAGGGCCAGCCTGGGAGG - Intergenic
1114499958 14:23161307-23161329 CCCAGCAGGGAGAGCCTGTGTGG - Intronic
1114511540 14:23266064-23266086 CTTGGGAGGCTGAACCTGGGAGG - Intronic
1115772533 14:36680812-36680834 CCTGTCAGGCAGAGGCTGTTCGG + Intronic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1117375563 14:55115520-55115542 CCAGGCAGGCAGCATCTGGGAGG + Intergenic
1118716426 14:68563330-68563352 CCTGGCAGGCTGAGCTGGAGGGG - Intronic
1118751240 14:68809025-68809047 GCCGGCAGGCAGAGCCACGGCGG - Intergenic
1118845322 14:69543721-69543743 ACTGGCAGGCCCAGCCTGGCTGG + Intergenic
1119209597 14:72821192-72821214 GGTGGGAGGCAGAGCCTGGGAGG + Intronic
1119390310 14:74287135-74287157 CCTGCCAGGCACAGCTTGGTGGG + Intronic
1119420243 14:74503849-74503871 ACTGGCTGGCAGGGGCTGGGTGG + Intronic
1119552478 14:75525062-75525084 CCTGGGAAGCAGAGACGGGGAGG - Exonic
1119656746 14:76422571-76422593 CCTGGCAGCCACAGCAAGGGTGG - Intronic
1119718844 14:76877490-76877512 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1119952184 14:78756475-78756497 CCTGGGTGACAGAGCCTGGGTGG + Intronic
1120061051 14:79983193-79983215 AGTGGCAGGCAGAGCCAGGCAGG - Intergenic
1121148680 14:91609826-91609848 CTCGGGAGGCTGAGCCTGGGAGG - Intronic
1121192399 14:92041937-92041959 TCTGGCAGGCAGGGGCGGGGGGG + Exonic
1121329005 14:93038140-93038162 CTTGGGAGGCTGAACCTGGGAGG - Intronic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1121562768 14:94887104-94887126 CCTGTGAGGCAGAGCCCGGCTGG - Intergenic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1121811055 14:96890701-96890723 CCTGGCAGACAAAATCTGGGTGG + Intronic
1121916194 14:97838618-97838640 CAGGGCAGGGAGAGCCAGGGCGG + Intergenic
1122690161 14:103528473-103528495 CGGGGGAGGCAGGGCCTGGGCGG + Intergenic
1122765225 14:104064524-104064546 CCTGCCAGTCAGTGCCTGGCAGG - Intergenic
1122884115 14:104702996-104703018 CCTGGCAGGCAGACGCCAGGGGG - Intronic
1122911841 14:104833609-104833631 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1122935659 14:104954888-104954910 CCCTGCTGGCTGAGCCTGGGAGG - Intronic
1122984908 14:105207564-105207586 CCTGGCAGGCCCAGCCCGGAAGG + Intergenic
1123001974 14:105300708-105300730 CCTGGGCGGCTGGGCCTGGGCGG - Exonic
1123034793 14:105467496-105467518 CCTGGCAGGCACGTCCTGTGGGG + Intronic
1202893759 14_KI270722v1_random:183657-183679 GCAGGCTGGCCGAGCCTGGGAGG + Intergenic
1124328119 15:28784250-28784272 CCTGGGAGGCCGAGGCTGCGGGG - Intergenic
1125511695 15:40295571-40295593 CATGCCAGGCTGAGCCTAGGGGG + Intronic
1125649813 15:41307381-41307403 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1125672016 15:41480602-41480624 CTTGGCTGGCGGAGCCTTGGAGG - Exonic
1125935035 15:43627795-43627817 CCTGGTAGGCTAAGCCTAGGAGG - Intergenic
1126170959 15:45694920-45694942 CTCGGGAGGCTGAGCCTGGGAGG - Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1127293088 15:57587671-57587693 GATGGCAGACAGAGCCTGGAAGG - Intergenic
1127804613 15:62507532-62507554 CCTGGGAGGCAGAGCACAGGTGG + Intronic
1127805261 15:62513346-62513368 CCTGGCAGGCAGGTGTTGGGAGG - Intronic
1127976305 15:63999692-63999714 TCTGGCAAGCAGAGCTAGGGTGG - Intronic
1128130393 15:65223504-65223526 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1128218920 15:65953968-65953990 CCGGGCAGGGAGAGCTGGGGTGG + Intronic
1128359430 15:66950745-66950767 CCTGGCTGCCAGGGCTTGGGTGG + Intergenic
1128684764 15:69675648-69675670 CCTGAAAGGCAGAGCCTCGCAGG - Intergenic
1128815782 15:70607087-70607109 CCTGGCAAGCACAGCCATGGGGG + Intergenic
1129183539 15:73891923-73891945 GGAGGCAGGCAGATCCTGGGTGG + Intergenic
1129199153 15:73988537-73988559 CCTGGCAGGTGGAGCCAGGCCGG + Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1129657164 15:77531892-77531914 GCTGGGAGGCAGATCCTGGGTGG + Intergenic
1129786491 15:78313516-78313538 CCGGGGAGGCAGAGGCGGGGTGG + Intergenic
1129888785 15:79057309-79057331 CCTGGCAGTCAGGGCAGGGGAGG + Intronic
1130028840 15:80294100-80294122 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
1130040369 15:80401226-80401248 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1130296180 15:82648099-82648121 CCTAGCAGGCCGAGCCGAGGAGG + Intronic
1130557129 15:84930512-84930534 CCTGGGATTCAGAGCCTGAGAGG + Intronic
1130650717 15:85760666-85760688 CCGGGCAGGCAGGGGCAGGGAGG - Exonic
1131180100 15:90233703-90233725 CCTGGAAGGCAAAGCCAGAGCGG + Exonic
1131383182 15:91981220-91981242 CCTGGCTGGCAGAGCAAGGAGGG - Intronic
1131383810 15:91986107-91986129 CCTGGTGGGCAGAGGCTGAGTGG + Intronic
1132011404 15:98279717-98279739 CCTGGTAGGCAATGACTGGGGGG + Intergenic
1132079286 15:98851240-98851262 CCAGGCGGGCAGGGCCGGGGTGG + Intronic
1132549176 16:547343-547365 CGTGGCAGCGAGAGCCTGCGTGG - Exonic
1132589659 16:721126-721148 AGTGGCCGGCAGAGCCTGCGCGG - Exonic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1132670419 16:1100205-1100227 CCTGGCGGGCGGAGCCTGCACGG - Intergenic
1132804562 16:1769545-1769567 CTGCCCAGGCAGAGCCTGGGGGG - Exonic
1133597183 16:7304126-7304148 CCAGGCGGGGAGAGCCAGGGAGG + Intronic
1133926901 16:10200581-10200603 CCTGGCAGCCAGAGAAGGGGTGG + Intergenic
1134039862 16:11060199-11060221 GCTGGCAGGGAAAGCCTGAGGGG + Intronic
1134095288 16:11414811-11414833 CCTGGCAGCCAAGGACTGGGAGG - Intronic
1134176142 16:12008017-12008039 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
1134371482 16:13630079-13630101 CTTGGGAGGCTGAGCCTGGGAGG - Intergenic
1134821083 16:17247983-17248005 TCTGGCAGGCTGGGACTGGGGGG - Intronic
1135571492 16:23552732-23552754 CTTGGGAGGCCGAGGCTGGGGGG - Intronic
1135770810 16:25217085-25217107 CCAGGCTGGCAGAGCAAGGGGGG + Intronic
1135998728 16:27273436-27273458 CCTGGGAGGTAGAGCCCAGGAGG + Intronic
1136003956 16:27315585-27315607 TCTGGCAGGTAGAGGATGGGAGG + Intronic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136269779 16:29141716-29141738 CCTGGGACGCCGAGGCTGGGTGG + Intergenic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1136611683 16:31370369-31370391 CAGGGGAGGCAGTGCCTGGGAGG + Intronic
1137277882 16:46949021-46949043 CTTGGGAGGCTGAGCCAGGGAGG - Intergenic
1137394067 16:48104763-48104785 GGTGGCAGCCAGGGCCTGGGAGG - Intronic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1138230097 16:55330456-55330478 CCTTGCACGCAGAGCTGGGGTGG + Exonic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1139187473 16:64823720-64823742 TCTGGCAGGCAGTATCTGGGAGG - Intergenic
1139374969 16:66491206-66491228 TCTGGCAGACAGAGCCATGGAGG - Intronic
1139841863 16:69888228-69888250 CCCAGCAGGCAGAGCGTCGGGGG - Exonic
1141461279 16:84180028-84180050 CCTGGAAGGAAGAGACTGGGGGG + Exonic
1141627611 16:85269606-85269628 CCGGGCATGCAGAGCACGGGAGG - Intergenic
1141684939 16:85564813-85564835 TCTGGCCTGCAGAGCCTGGGAGG - Intergenic
1141694440 16:85613038-85613060 CCTGGCCGGCCGGGCCGGGGAGG + Intronic
1141950149 16:87334737-87334759 CCTGGCAGACAGCGCCTGAAGGG - Intronic
1141958696 16:87390838-87390860 TCAGGGAGGCAGAGGCTGGGAGG - Intronic
1141992809 16:87620184-87620206 CAGCGCAGGCTGAGCCTGGGTGG + Intronic
1142073403 16:88103647-88103669 CCTGGGATGCCGAGGCTGGGTGG + Intronic
1142236337 16:88924337-88924359 CCAGGGAGGCAGGGCCAGGGCGG - Intronic
1142306546 16:89289149-89289171 CCGGGCAGGCAGCTCCTGGCTGG + Intronic
1143015588 17:3889719-3889741 CCTGGGAGGAAAAACCTGGGTGG - Intronic
1143521871 17:7448908-7448930 AACGGGAGGCAGAGCCTGGGCGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1143806722 17:9434623-9434645 GCAGGCAGGCTTAGCCTGGGAGG + Intronic
1144547492 17:16211348-16211370 CTTGGGAAGCTGAGCCTGGGAGG - Intronic
1144560347 17:16316015-16316037 ACTGCCTGGCAGAGCCTGAGAGG - Intronic
1145061556 17:19737407-19737429 CCTGCCAGGCCCAGGCTGGGAGG + Intergenic
1145183679 17:20775532-20775554 ACTGGCAGCCAGAGGCGGGGAGG - Intergenic
1145261496 17:21357461-21357483 GCTGGCAGGGAAAGCCAGGGAGG - Intergenic
1145725192 17:27114304-27114326 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1145763531 17:27442067-27442089 CCCGGGAGGCAGAGGTTGGGAGG + Intergenic
1146003891 17:29148928-29148950 CCGGCCAGCCGGAGCCTGGGCGG + Intronic
1146373847 17:32281361-32281383 CCTGGGAGGCAGCCCCTAGGAGG + Intronic
1146683589 17:34825710-34825732 TCTGGGAGGCACATCCTGGGAGG - Intergenic
1146795043 17:35774725-35774747 GCTGGGAGGCAGAGGTTGGGTGG - Intronic
1146891118 17:36507058-36507080 CCTGGCAGGCAGCCCCTGCCTGG - Exonic
1147138772 17:38450022-38450044 CCTGTGAGGGATAGCCTGGGAGG + Intronic
1147141622 17:38463625-38463647 CCAGGCTGGCAGAGCCTGCTGGG - Intronic
1147366854 17:39964725-39964747 GCTGGCAACAAGAGCCTGGGTGG - Intronic
1147477787 17:40729844-40729866 CCTGGGAGACAGAGGCAGGGGGG + Intergenic
1147659608 17:42110607-42110629 CCTGCCATGGAGAGCCTGGTAGG + Intronic
1147889967 17:43710280-43710302 GCTGACAGGCAGGCCCTGGGCGG + Intergenic
1148287739 17:46410631-46410653 CCTGGGAGGCTGAGGTTGGGAGG + Intergenic
1148309908 17:46628211-46628233 CCTGGGAGGCTGAGGTTGGGAGG + Intronic
1148772977 17:50077514-50077536 GCAGGCAGGCAGAGGCTGGAAGG - Intronic
1148965078 17:51428129-51428151 GCTGGGAGCCAGAACCTGGGGGG + Intergenic
1150303959 17:64068693-64068715 GCTGGCAGGTGGAGGCTGGGAGG + Intronic
1150445419 17:65224397-65224419 CCCCTCAGGCAGAGCCGGGGTGG - Intronic
1150906950 17:69347995-69348017 CTTGGGAGGCTAAGCCTGGGAGG + Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151383831 17:73743214-73743236 GCGGGGAGGCCGAGCCTGGGAGG - Intergenic
1151493183 17:74444509-74444531 CCCGGCTGGCAGAGGCTGTGGGG + Intronic
1151517809 17:74607666-74607688 CGTGGAAGGCAGAGCCATGGAGG + Intergenic
1151551700 17:74826173-74826195 CCTGGCAGGTGGCGCCTGGGAGG - Intronic
1151711062 17:75806981-75807003 CCTGCCAGCCAGAGCCTCTGTGG + Intronic
1151759330 17:76091614-76091636 CCAGGGTGGGAGAGCCTGGGGGG + Intronic
1151767030 17:76137937-76137959 CCTGGCGGGCAAAGGCTGGGTGG + Exonic
1151890419 17:76947978-76948000 CCTGGCTGGCCGTGCCTGGGAGG + Exonic
1151986663 17:77548256-77548278 CCTTGCAGGCAGAGGCCTGGCGG - Intergenic
1151990380 17:77570636-77570658 CCTGGCTGGAAGCCCCTGGGAGG + Intergenic
1152126546 17:78450635-78450657 CCTGGCAGCCAGGGCTTGGGAGG - Intronic
1152314529 17:79572491-79572513 CCTGGTGGGCAGAGCTGGGGTGG - Intergenic
1152318424 17:79594455-79594477 TGTGGGAGGCAGAGCCTGGAGGG - Intergenic
1152434859 17:80270215-80270237 GCTGGGTGGCAGAGCCAGGGAGG - Intronic
1152538138 17:80962081-80962103 CCCGGGAGACAGAGCCTGGATGG - Intronic
1152691515 17:81720270-81720292 CCTGGTAGCCAGAGCGGGGGTGG - Exonic
1152811630 17:82385350-82385372 CCAGGCTGGGAGGGCCTGGGGGG + Intergenic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153062950 18:1012971-1012993 CCAGCCAGGCAGAACCTGTGTGG - Intergenic
1153524290 18:5979934-5979956 CCTGCCAGGCAGAGCCCAGGTGG - Intronic
1154317354 18:13315215-13315237 TCTGGCAGGCAGAGCAGGGCAGG - Intronic
1155050895 18:22146846-22146868 CCTGGCAGGCAGATGAAGGGAGG - Intergenic
1155055335 18:22177186-22177208 CAAGGCAGGCCGAGCCAGGGCGG - Intronic
1155125897 18:22875414-22875436 CTCGGGAGGCTGAGCCTGGGAGG - Intronic
1155743776 18:29324620-29324642 CCTGGGAGGCGGAGATTGGGAGG - Intergenic
1156274163 18:35566084-35566106 CCTGGGAGGTTGAACCTGGGAGG + Intergenic
1156350897 18:36300073-36300095 CCATGCATTCAGAGCCTGGGTGG - Intronic
1157760265 18:50257957-50257979 CCTGGGAGGCAGAGGTTGCGGGG + Intronic
1158333891 18:56393854-56393876 CCAGGAAGGCAGAGCATGGCAGG + Intergenic
1160259089 18:77274365-77274387 CTTTGCCTGCAGAGCCTGGGTGG - Exonic
1160603864 18:80034352-80034374 CCTGGCAGGCGGCGTGTGGGCGG - Exonic
1160733642 19:652132-652154 GCGGGCAGGGAGAGCCGGGGAGG + Intronic
1160755370 19:754385-754407 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1160793205 19:932529-932551 CCAAGCTGGCAGGGCCTGGGGGG - Exonic
1160911038 19:1473920-1473942 CCTGCCACACACAGCCTGGGAGG - Exonic
1161069995 19:2255287-2255309 CATGACAACCAGAGCCTGGGAGG - Exonic
1161323755 19:3653203-3653225 CTGGGCAGGCAGGGCCAGGGAGG - Intronic
1161376579 19:3942179-3942201 CCTGGCTGGGCGAGCCGGGGAGG - Exonic
1161457296 19:4375811-4375833 CCTGCCAGGCGGAGCCTCAGGGG - Intronic
1161504127 19:4635035-4635057 CCTGGGAGGTTGAACCTGGGAGG - Intergenic
1161645748 19:5452254-5452276 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1161717040 19:5882116-5882138 CCTGGCAGGAGGGACCTGGGAGG - Intronic
1161785052 19:6319362-6319384 CCCGCCTGGCAGAGCCTGGGTGG - Intronic
1162531388 19:11238181-11238203 ACTGACCGGCAGAGCCTGGCTGG + Exonic
1162745118 19:12793703-12793725 CCTGCCCGGCAGAGCGGGGGAGG - Intronic
1162782846 19:13015599-13015621 CCTGGCAGGCAGGGAATGGGGGG - Intronic
1163102703 19:15107678-15107700 CCTGGAAGGAAGGGGCTGGGAGG + Intronic
1163303593 19:16463223-16463245 CCTGGTGGGCAGAGCCTGGTGGG - Intronic
1163440064 19:17318126-17318148 CCTGGGAGGTGGAGACTGGGAGG - Intronic
1163640846 19:18461193-18461215 CGTGCCTGGCAGAGCCTGGCAGG - Intronic
1163905256 19:20146734-20146756 TCTGGGAGGCTGAACCTGGGAGG + Intergenic
1163967932 19:20765218-20765240 CCTGGGAGGCAGAGATTGCGGGG + Intronic
1164607600 19:29611276-29611298 CCCGGGAGGCAAACCCTGGGAGG - Intronic
1164925799 19:32129104-32129126 CCTGGAAGGCAGAACTTGGTGGG - Intergenic
1165105933 19:33469744-33469766 CCTGGCAGGCAGCGTAGGGGAGG - Intronic
1165232407 19:34395284-34395306 CTTGGGAGGCAGAGGCTGGGGGG + Intronic
1165325738 19:35113486-35113508 CTTTGCAGGTAGAGCCTGAGCGG - Intergenic
1165386660 19:35514033-35514055 CCAGGCTGGCTGAGCCTGGGTGG - Intergenic
1165682485 19:37789702-37789724 CCCGGGAGGCAGAACCCGGGAGG + Intronic
1165873679 19:38991032-38991054 CGGGGCAGCCAGAGCCTGGCAGG + Intronic
1165968276 19:39603328-39603350 ACAGGCAAGCTGAGCCTGGGAGG - Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166082408 19:40452249-40452271 GCTGGGAGGCAGAACCTGGCTGG - Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166667868 19:44692130-44692152 CCTGGTGGGCAGAACTTGGGTGG - Intergenic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166785246 19:45363515-45363537 CCTGGCAGGCAACACCTGGCTGG - Intronic
1167030396 19:46955413-46955435 CGTGACAGACAGAGCCTGAGAGG + Intronic
1167078397 19:47263006-47263028 CTTGGGAGGCTGAGCCTGGGAGG + Intronic
1167174954 19:47859148-47859170 CCTGGCAGGGTGGGCCAGGGTGG + Intergenic
1167303269 19:48692148-48692170 CCTGGGAGGCAGAGGCGGGGTGG - Intergenic
1167957097 19:53074592-53074614 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
1168284116 19:55321952-55321974 CCAGGCAGGCTGAGCATGGGTGG + Intronic
1168293723 19:55369251-55369273 CGGGGCAGCCAGAGCCAGGGAGG - Intronic
1168353613 19:55689531-55689553 CAAGTCAGACAGAGCCTGGGTGG + Intronic
1168721379 19:58556640-58556662 CCTGGCAGGCAGCGCTGAGGAGG + Intronic
925343849 2:3155707-3155729 CATGGCAGGCGGGGCTTGGGGGG + Intergenic
925360741 2:3278521-3278543 CCTGGCAGGAGCAGGCTGGGAGG + Intronic
926048844 2:9730223-9730245 CGTGGCACGCAGTGCATGGGAGG - Intergenic
926122847 2:10254239-10254261 CCAGGCCAGCAGAACCTGGGAGG - Intergenic
926237278 2:11055195-11055217 TCTGGGAGGCTGGGCCTGGGAGG - Intergenic
927216197 2:20669044-20669066 CTTGGCTGGCTGAGCCTGAGAGG + Intronic
928238514 2:29566125-29566147 CCAGGCAGGGTGACCCTGGGTGG - Intronic
928404375 2:31003480-31003502 CCTGGCTGGCAGACCCTCCGGGG - Intronic
929109419 2:38393925-38393947 CCTGGGAGGCTGAGGGTGGGTGG + Intergenic
929313632 2:40452361-40452383 GCTCGCCGGCAGAGGCTGGGAGG - Intronic
929474598 2:42233379-42233401 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
929967815 2:46548653-46548675 CCCGGTGAGCAGAGCCTGGGAGG + Intronic
930284294 2:49408924-49408946 CCTTGGAAGCAGAGCCTGGGAGG - Intergenic
931334320 2:61323437-61323459 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
932843997 2:75116178-75116200 CCTGGGAGGCAGAGGTTGAGAGG - Intronic
933093257 2:78146601-78146623 CTTGGCATGAACAGCCTGGGTGG + Intergenic
933813463 2:86047865-86047887 CAGGAGAGGCAGAGCCTGGGTGG + Intronic
934089990 2:88542850-88542872 CCTGGGAGGCAGTGTCAGGGTGG + Intergenic
934781171 2:96970594-96970616 CAGGGCAGGCTGAGTCTGGGTGG + Intronic
934781584 2:96972606-96972628 CCTGGAAGGAAGCGCCTGTGAGG + Exonic
935620611 2:105126406-105126428 CGTGGCAGTCAGAGCTTGGGAGG - Intergenic
935753505 2:106259662-106259684 CCTGGGAGGCAGAGCTTGTAGGG + Intergenic
936046880 2:109195299-109195321 TGTGGCAGGCAGTTCCTGGGAGG + Intronic
937398483 2:121560507-121560529 CCTGGCAGGCAGCTTCTGAGGGG - Intronic
937413662 2:121697572-121697594 TCTAGGAGGCAGAGTCTGGGTGG + Intergenic
937885249 2:126895078-126895100 CCTGGCTGTCAGAGTCTGGGTGG - Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938770178 2:134494974-134494996 CCTGGGAGGGAGAACCTGGGAGG - Intronic
938778070 2:134559544-134559566 CCAGACAGGCAGAGCCCCGGAGG - Intronic
940067535 2:149646785-149646807 CCTGGGAGGCGGAGCTTGAGTGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941717186 2:168776689-168776711 CTTGGGAGGCTGAGCTTGGGGGG - Intergenic
941956773 2:171213308-171213330 CCTGGCAGGCTGAGGTTGGGAGG - Intronic
942045171 2:172095696-172095718 CGTGCCTGGCAGATCCTGGGTGG + Intergenic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
946162665 2:217845660-217845682 CATGGCAGCCAAAGCCTGAGAGG + Intronic
946426130 2:219598086-219598108 GCTGGGGGGCGGAGCCTGGGGGG - Exonic
946692473 2:222319716-222319738 CCGGGCGGGCAGAGCCAGGGCGG + Intergenic
947359615 2:229334072-229334094 CTTGGGAGGCTGAACCTGGGAGG - Intergenic
947527194 2:230885981-230886003 CTTGGAAACCAGAGCCTGGGCGG + Intergenic
947564786 2:231186667-231186689 CCTGTTGGCCAGAGCCTGGGAGG - Intergenic
947666524 2:231909462-231909484 CTTGGGAGGCTGAACCTGGGAGG - Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947713410 2:232328448-232328470 CCTGGCAGGCCCACCCTGGGTGG + Intronic
947837861 2:233188317-233188339 CCTGGCAGGCGGTGGCAGGGAGG - Intronic
948038112 2:234875807-234875829 CTAGGCAGGCAGAGGCTTGGTGG - Intergenic
948414598 2:237793623-237793645 CTTGGGAGGCTGAACCTGGGAGG + Intronic
948505580 2:238425226-238425248 CCAGGCAGGCAGAGCAGCGGAGG + Intergenic
948568959 2:238905301-238905323 CCAGGCAGGCAGATACAGGGAGG + Intronic
948622638 2:239246186-239246208 GCAGGCAGGCAGAGCCCGGTGGG + Intronic
948789197 2:240368686-240368708 CAAGACAGGCAGAGCCTGGAGGG + Intergenic
948824571 2:240568177-240568199 CCTGGCCGGCAGTGTCTGGGAGG + Intronic
1168871652 20:1134688-1134710 CCAGGCAGGCAGAGCTCTGGGGG - Intronic
1168998775 20:2151444-2151466 GCTTGGAGGCAGAGCCTGAGGGG - Intronic
1169192624 20:3667812-3667834 GCTGGCAGGCCGAGCCTAGGTGG - Intergenic
1169859038 20:10132546-10132568 ACAGGCAGGCAGAGCCCTGGGGG - Intergenic
1170695306 20:18652451-18652473 GCTGGCAGGCTGAGTCTGGAGGG + Intronic
1171225350 20:23437977-23437999 CCTGGGAGGCTGAGGCTAGGAGG - Intergenic
1171294231 20:24003690-24003712 CCTGGCAAGCAGAGGCAGGGCGG - Intergenic
1171386605 20:24773597-24773619 CCTGGAAGGGATAGCCTTGGTGG + Intergenic
1171429732 20:25074828-25074850 TCTGGGAGGCAGAACCTGTGTGG + Intronic
1172030126 20:31975913-31975935 CCTGCCAGGTAGAGACTGCGAGG + Intronic
1172198902 20:33111631-33111653 CCTGGCAGGCTGACCATGGAAGG - Exonic
1172276952 20:33685238-33685260 CATGGCAACCAGGGCCTGGGAGG + Intronic
1172612107 20:36260057-36260079 CCTGGCAGGCTGGGGGTGGGTGG - Intronic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1174276824 20:49409947-49409969 CCTGGCAGCTAGAGCCTATGGGG + Intronic
1174619689 20:51864604-51864626 CCTTCCAGGTAGAGCCTGGGTGG - Intergenic
1175116437 20:56685915-56685937 CCAGGCAGGCACATCCTGGTTGG - Intergenic
1175263618 20:57689713-57689735 CCTGGGAGGCAGATTCAGGGCGG - Intronic
1175414404 20:58792416-58792438 TCTGCCAGCCAGAGCCTGGATGG + Intergenic
1175507124 20:59494001-59494023 CCTGAAAGCCAGAGCCTGGTTGG - Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175598613 20:60255157-60255179 CCTGTCAGGCAGGGCCAAGGAGG + Intergenic
1175712694 20:61233451-61233473 ACATGCAGGCAGAGCCAGGGTGG + Intergenic
1176027443 20:62993324-62993346 GGAGGCAGGCAGAGGCTGGGAGG + Intergenic
1176146771 20:63568985-63569007 CCTGCCAGGCTGACCCTGCGGGG - Exonic
1176191311 20:63811407-63811429 CCTGGAAGTCAGAAGCTGGGAGG - Intronic
1176249554 20:64113930-64113952 CCTGGCAGGCAGGACATGGCAGG - Intergenic
1176257735 20:64160886-64160908 CCTGCCAGGCAGATCCAGGCAGG - Intronic
1177357655 21:20030540-20030562 CCTGGCAGGCTGTGCTTGGCTGG + Intergenic
1178586751 21:33877127-33877149 CCTGGGAGGCAGAGGTTGCGGGG - Intronic
1179046810 21:37852101-37852123 CCTGGAAAGCAAAGGCTGGGTGG + Intronic
1179615302 21:42579637-42579659 CCTGGCCCGCAAGGCCTGGGCGG - Intronic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1180105155 21:45613530-45613552 CCTGGCAGGCCGAGTGTAGGAGG + Intergenic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180187374 21:46146211-46146233 CCCGAGAGGCAGAGCCCGGGAGG + Intronic
1180603062 22:17035404-17035426 CCTGGCAGGCAGAACTGCGGTGG + Intergenic
1180979237 22:19871016-19871038 TCTGGGAGGCAGAGTGTGGGAGG - Intergenic
1181000161 22:19984324-19984346 TCTGACAGGCAGAGCTGGGGTGG + Intronic
1181179475 22:21056751-21056773 CCTGGGAGGGAAAGGCTGGGAGG - Intronic
1181484260 22:23220515-23220537 CCTAGCAGACCAAGCCTGGGTGG - Intronic
1181528808 22:23504429-23504451 CCAGGGAGGGAGGGCCTGGGGGG - Intergenic
1181672573 22:24432557-24432579 CCTGAGAGGCTGAGCATGGGGGG + Intronic
1182202323 22:28586201-28586223 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1182353508 22:29711632-29711654 CCTGGTAGGCAGGGCCAGGTGGG - Intergenic
1182546936 22:31081945-31081967 CCTAACAGGCAGAGATTGGGAGG + Intronic
1183227692 22:36561669-36561691 ACTCGCAGGCAGAGGCAGGGGGG + Intergenic
1183278846 22:36921623-36921645 ACTGGCAAGCAGAGGGTGGGGGG + Intronic
1183381477 22:37492483-37492505 GGTGGCAGGCTGAGCCTTGGGGG + Exonic
1183483676 22:38078099-38078121 GGTGGCAGCCGGAGCCTGGGCGG + Intergenic
1183622389 22:38982106-38982128 CATTGCAGCCTGAGCCTGGGAGG - Intronic
1184098224 22:42328149-42328171 CCTGCATGGCTGAGCCTGGGAGG - Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184330498 22:43824154-43824176 GCTCCCAGGCAGAGACTGGGAGG + Intergenic
1184362106 22:44024723-44024745 CCCGGCAGGCAGAGCAGGCGCGG - Intronic
1184509548 22:44925677-44925699 CTTGGCTGGCACAGCCTGGCGGG + Intronic
1184890339 22:47375298-47375320 CCTGGCAGGGAACCCCTGGGAGG + Intergenic
1185008435 22:48299511-48299533 CCTGGGACACGGAGCCTGGGGGG - Intergenic
1185210358 22:49567284-49567306 CCAGGCATGCAGAGCCTTTGCGG + Intronic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949931487 3:9082033-9082055 CATTGGAGGCAGAGCCTGGCAGG + Intronic
950111883 3:10423915-10423937 GCTGGCGCCCAGAGCCTGGGTGG + Intronic
950523982 3:13513043-13513065 CCTGGCTGGGAGAGCCTTGGGGG - Intergenic
952860165 3:37806475-37806497 CCTGAGAGGCAGAGCCAGGTGGG - Intronic
953232394 3:41076549-41076571 CCTGGGAAGCAGAGCATGGCAGG + Intergenic
953236295 3:41110447-41110469 TCTGGCAGCAAGATCCTGGGAGG - Intergenic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
953563790 3:44014183-44014205 TCTGGCTGGCAGAGCCTCTGTGG + Intergenic
953742739 3:45551533-45551555 CCTGACACTCAGAGCGTGGGTGG + Intergenic
954256744 3:49412452-49412474 CGTGGCCGGCAGAGCCTGCAAGG - Exonic
954343065 3:49971188-49971210 CCTGGGAGGCAGAGGTTGCGGGG + Intronic
954389424 3:50260890-50260912 CCTGGAAATCTGAGCCTGGGTGG - Intergenic
954504250 3:51053495-51053517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
954580536 3:51700702-51700724 CCTGACAGGCAGTGTTTGGGAGG - Intronic
954608679 3:51932896-51932918 CCTGGCAGGTAGGTCCTGGCAGG + Intergenic
954622787 3:52005376-52005398 CCTGGTGGGCAGAGGCTGGTGGG + Intergenic
954791844 3:53139203-53139225 CCTGGGAGGCAGAGCAGGGGAGG - Intergenic
954972869 3:54665825-54665847 CCTGGGTGGCGGAACCTGGGTGG - Intronic
954988069 3:54813271-54813293 CCAGCAAGGCAGAGCCTGGTTGG + Intronic
955929172 3:64038551-64038573 CCTGGCAGGGAGGCCCTCGGGGG - Intergenic
956212221 3:66813848-66813870 CCTGGGAGGTTGAACCTGGGAGG + Intergenic
956938213 3:74128121-74128143 CCTGTCAGACACAGCCTGTGTGG - Intergenic
957574064 3:81986557-81986579 CCTGGCAGGGAGAGGAGGGGAGG - Intergenic
957822914 3:85401311-85401333 TCTGGCAGACAGAGGCTGAGAGG - Intronic
959295683 3:104531342-104531364 CATTGCAGACAGAGCCTTGGTGG + Intergenic
959799483 3:110474601-110474623 CCTGGCAGGCAGAGTGATGGAGG + Intergenic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
960364322 3:116752495-116752517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
960455488 3:117866298-117866320 CTTGGAAGAAAGAGCCTGGGAGG - Intergenic
961237008 3:125375526-125375548 CCTCCCAGGCCCAGCCTGGGGGG - Intergenic
962935459 3:140076551-140076573 CCTGTCAGCCAGAGTGTGGGAGG - Intronic
963258448 3:143169641-143169663 CCTGGCAGGCAGGGCCTTCTGGG + Intergenic
964528519 3:157642178-157642200 CCTGGCAGGTATAGCATGTGTGG - Intronic
966267547 3:178064484-178064506 CCTGGGAGGCAGAGGTTGCGGGG - Intergenic
966489964 3:180516789-180516811 CATTGCAGTCAGAGCCTTGGTGG + Intergenic
966516159 3:180822903-180822925 CCTTGAAGGCAGAGGGTGGGAGG + Intronic
966862475 3:184238312-184238334 CCTGGCTGGCAGAGCTCGGGTGG + Exonic
966975308 3:185077648-185077670 GCTGCCCGGCAGAGCTTGGGGGG - Intergenic
967224146 3:187275000-187275022 TCTGGGAGGGAGAGCCAGGGAGG + Intronic
968177944 3:196567856-196567878 CTTGGGAGGCTGAGCCCGGGAGG - Intronic
968605326 4:1532595-1532617 CCTGGCAGGCTGGACCTGGGTGG - Intergenic
968979065 4:3836992-3837014 CACAGGAGGCAGAGCCTGGGGGG - Intergenic
969137895 4:5045187-5045209 CCGCTCAGGCAGAGCCTGGCAGG - Intergenic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969659161 4:8516306-8516328 CTTGGCACGCAGAGCCTGAAGGG - Intergenic
969853336 4:9979505-9979527 CCTGGGAGGCATCCCCTGGGAGG + Intronic
969882722 4:10188530-10188552 CCAGCCAGCCAGACCCTGGGAGG - Intergenic
971372061 4:26027759-26027781 GCTGGAAGGCAGAGTCTGGTTGG + Intergenic
971671735 4:29567082-29567104 CTTGGCACACACAGCCTGGGTGG - Intergenic
972334969 4:38099689-38099711 GCTTGCAGGCAGGGTCTGGGAGG - Intronic
972578247 4:40371865-40371887 CTTGGGAGGCTGAGCCGGGGAGG - Intergenic
973027671 4:45293227-45293249 CATTGCAGTCAGAGCCTAGGTGG - Intergenic
974683527 4:65195158-65195180 CTTGGCAAGAACAGCCTGGGTGG - Intergenic
976090904 4:81456596-81456618 ATTCCCAGGCAGAGCCTGGGTGG - Intronic
976729288 4:88245558-88245580 CCTGGCAGGCTGATCTTGGCTGG - Intergenic
979275310 4:118809047-118809069 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
979529157 4:121750393-121750415 CCTGGGAGGCAGAGCTTGCTGGG + Intergenic
980134333 4:128845580-128845602 CCTGGGAGGTAGGGCCTGGGTGG + Intronic
980148167 4:129015113-129015135 CATTGCAGACAGAGCCTTGGTGG - Intronic
981200722 4:141976199-141976221 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
982220533 4:153121273-153121295 CCTGGGAGGCGGAGCTTGCGTGG + Intergenic
982229214 4:153193205-153193227 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
982613642 4:157612217-157612239 CCTGGGAGGCAGAGCTTGCGCGG - Intergenic
984526775 4:180867031-180867053 CTCGGCAGGGACAGCCTGGGTGG - Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
985383367 4:189419384-189419406 TGTGCCCGGCAGAGCCTGGGTGG + Intergenic
985645731 5:1083942-1083964 CCCAGGAGGCAGACCCTGGGCGG + Exonic
985846620 5:2354259-2354281 CTTAGCAGGCAGAGCCAAGGAGG - Intergenic
986172168 5:5323993-5324015 CCAGGCAGCCAGAGCATGTGTGG - Intergenic
986706836 5:10459743-10459765 GCAGGCAGGCAGTGCCGGGGTGG - Intronic
986910956 5:12556363-12556385 CCTGGGAGGCAGAGGTTGTGGGG - Intergenic
988864975 5:35324617-35324639 CATTGCAGTCAGAGCCTTGGTGG + Intergenic
989023234 5:37035179-37035201 TGTGGGAGGCTGAGCCTGGGAGG + Intronic
989374273 5:40743663-40743685 CCTGGGAGGCTGAGGCAGGGAGG + Intronic
989593599 5:43135072-43135094 CCTGGGAGGCGGAGGTTGGGGGG - Intronic
990761968 5:59139575-59139597 CTTGGGAGGCAGAGCCTGGGAGG - Intronic
991044384 5:62208037-62208059 CCTGGGTGGTAGTGCCTGGGTGG - Intergenic
992444898 5:76824434-76824456 CTTGGGAGGCTGAACCTGGGAGG - Intronic
992773507 5:80070258-80070280 CCTGGGAAGCTGAGCCTGGCAGG - Intronic
995487845 5:112657132-112657154 ACTGGCAGGAAGGGCTTGGGAGG + Intergenic
996626471 5:125576002-125576024 GCTGGCAGCCAGTGCCTCGGAGG - Intergenic
996790516 5:127289409-127289431 CCTGGCAGAGAGGGCCTGAGGGG + Intergenic
996954216 5:129164144-129164166 CATTGCAGTCAGAGCCTTGGTGG - Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
998008365 5:138672719-138672741 CTTGGAAGGCTGAGCCTGGGAGG + Intronic
999101368 5:149028504-149028526 CAGGCCTGGCAGAGCCTGGGAGG - Exonic
999260971 5:150238847-150238869 TCTGGAAGGCAGAGCCTGTGAGG - Intronic
999375999 5:151086955-151086977 CCTGGCTGGCAGGACATGGGAGG + Intronic
1001058456 5:168468313-168468335 GGTGGCAGGCAGAGCCAGGGAGG - Intronic
1001445209 5:171777538-171777560 TGTGGCAAGCAGAGGCTGGGAGG - Intergenic
1001489695 5:172146634-172146656 CCTGGCGCACAGAGCCTGCGAGG + Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1002523638 5:179804430-179804452 CCAGGGAGGCAGACCCTTGGGGG - Intronic
1002580690 5:180208203-180208225 CCTGGCAGGCAGAGCTTCCCAGG + Intronic
1002911971 6:1497533-1497555 CCAGCCAGGCAGGGCCAGGGTGG + Intergenic
1003715159 6:8638186-8638208 CCTGCCAGGTAGAGTCAGGGTGG + Intergenic
1003963319 6:11229408-11229430 CCTGGCAGGCACAAACGGGGTGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1005836576 6:29713998-29714020 AGTGGCTGGCAGACCCTGGGTGG - Intergenic
1006029646 6:31170031-31170053 CCTGGCAGGCAGGGGCCAGGTGG - Intronic
1006253132 6:32807513-32807535 CATTGCAGACAGAGCCTTGGTGG - Intergenic
1006271560 6:32970155-32970177 CCTGGCCTGCAGAGCCCCGGTGG + Intronic
1006498240 6:34439810-34439832 CAGGGCTGGCAGAGGCTGGGGGG - Intergenic
1007432590 6:41785408-41785430 CCTGGCAGGCAAAGCAAGGCTGG - Exonic
1007495983 6:42260667-42260689 CCTGGCCTGCAGGGCCTGAGAGG - Intronic
1007533581 6:42564431-42564453 CCTCGCAGGCCGCGCCTGTGGGG + Intronic
1007589821 6:43014327-43014349 CCTGCCAGGCCGAGCCGGGGCGG - Exonic
1007646314 6:43384322-43384344 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1010213655 6:73382942-73382964 CTTGGAAGGCTGAGCCTGGGAGG - Intronic
1013192552 6:107815976-107815998 CCTGCCAGGCAGAGCAGGAGAGG + Intronic
1013367744 6:109447949-109447971 CCTGGCTGACAGGGCCTGCGGGG + Exonic
1013368434 6:109451565-109451587 CCTGGCCAGGAGAGGCTGGGTGG - Intronic
1013401481 6:109800951-109800973 CCTGGCAGGCAGGTGCTGTGGGG + Intronic
1013730819 6:113164559-113164581 CTTGGAAGGCTCAGCCTGGGAGG + Intergenic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1014254635 6:119148520-119148542 CCCTGCAGGCAGAGCAGGGGCGG - Intronic
1016058505 6:139603701-139603723 TCTGGGAGGCAGAGAGTGGGTGG + Intergenic
1016453627 6:144209519-144209541 CATTGCAGTCAGAGCCTTGGTGG - Intergenic
1016786998 6:148021916-148021938 GATGCCAGGCAAAGCCTGGGCGG - Intergenic
1017996056 6:159532434-159532456 CCTGGCAGTCAGAGAGAGGGGGG + Intergenic
1018297799 6:162367940-162367962 ACTGGGAGGCAGTGCCTTGGTGG - Intronic
1018550590 6:164992967-164992989 CCTGGGAGGCAGAGGTTGTGGGG + Intergenic
1018920262 6:168167693-168167715 CCTGACAGGTGGAGGCTGGGTGG - Intergenic
1019037562 6:169074245-169074267 CTTGGGAGGCAGAGGCGGGGGGG - Intergenic
1019387152 7:763688-763710 CCTGGCAGGCCCGGCCTGTGTGG + Intronic
1019447630 7:1079672-1079694 CGTGGCAGGCAGGCCCTGGCGGG + Intronic
1019506183 7:1392686-1392708 CCTGGGAGCCAGGGCCTGGAGGG + Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019683053 7:2363381-2363403 CCTGGGAGGTTGAGCCTGGGAGG + Intronic
1019775949 7:2912354-2912376 GGTGGCAGGCAGGGCCTGAGTGG - Intronic
1020034932 7:4959060-4959082 GGTAGCTGGCAGAGCCTGGGGGG + Exonic
1020117125 7:5482105-5482127 CGTGGCAGACAGAGCTGGGGAGG + Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020256167 7:6504067-6504089 CCTGTGAGGCAGAGCTGGGGCGG + Intronic
1021622803 7:22564791-22564813 CCTGGGAGTCTGAGCCTTGGAGG - Intronic
1022315529 7:29241561-29241583 CCTACCAGGCAGACCATGGGGGG + Intronic
1022476861 7:30716688-30716710 CCAGGCAGGCAGACCCAGAGAGG - Intronic
1022484265 7:30765804-30765826 CCTGACAGCCAGTCCCTGGGAGG + Intronic
1023335166 7:39161498-39161520 CCTGCCAGGCAGATCCAGGCTGG + Intronic
1023815829 7:43949326-43949348 CCTGGCAGGTGGAGCGTGGGAGG + Intronic
1023865190 7:44235093-44235115 CCAGGAAGGCAGGGCCCGGGAGG - Intronic
1024243815 7:47454757-47454779 CCAGCCAGGCAGAGCCAGGCAGG + Intronic
1024278496 7:47698412-47698434 CCTGGCTAGCAGAGCCCTGGAGG + Intronic
1024318931 7:48046097-48046119 CCTGGGACGCAGGGCCTGGAGGG + Intronic
1024573643 7:50746774-50746796 CCCGGGGGGCAGAGACTGGGTGG - Intronic
1024962649 7:54993955-54993977 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1025029647 7:55546827-55546849 CAGGCCATGCAGAGCCTGGGAGG + Intronic
1025258977 7:57404646-57404668 CCAGGCCGGCAGAGCCAGGCCGG - Intergenic
1026731957 7:72919588-72919610 CTTGGGAGGCTGAGCCTGGGAGG - Intronic
1027795720 7:82691174-82691196 CAAGCCAGGCACAGCCTGGGTGG - Intergenic
1028029491 7:85892159-85892181 CCTGGGAGGCTGAGGTTGGGAGG + Intergenic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1028684408 7:93575662-93575684 GCTGGCAGGCACGCCCTGGGAGG + Intergenic
1029535287 7:101154379-101154401 GCCGGGAGTCAGAGCCTGGGCGG + Exonic
1029729990 7:102433118-102433140 CTTGGCAGGGTGAGCCTCGGGGG - Intronic
1029731189 7:102439268-102439290 CCTGGCTGCCAGAGACTGGAGGG - Intronic
1030050510 7:105532904-105532926 CCTGGAAGGCTGAGTTTGGGCGG - Intronic
1032736542 7:134697534-134697556 CCAGGCAGGCACACCCTGGTTGG + Intergenic
1033482577 7:141756673-141756695 ACTGGCAGGCAGACCTCGGGAGG - Intronic
1034258266 7:149736357-149736379 CCCAGCAGGCAAAGGCTGGGAGG - Intergenic
1034979291 7:155466237-155466259 CGCGGCACGCAGAGCCCGGGAGG - Intergenic
1034994959 7:155571409-155571431 CCTGGCACTCAAAGCCTGGAGGG + Intergenic
1035112790 7:156497355-156497377 GCTGAGAGGCTGAGCCTGGGTGG + Intergenic
1035362991 7:158325729-158325751 CCGGGCAGGCAGAACCCCGGCGG + Intronic
1036209065 8:6827386-6827408 CCTGCCAGTCAGAGCCTTAGGGG - Intronic
1037313219 8:17577479-17577501 CCGGGCAGGCAAAGAGTGGGAGG - Intronic
1037820198 8:22131480-22131502 CCCGGCAGGCACAGCCCGGTTGG - Exonic
1037977974 8:23226413-23226435 CCCGGGAGGCAGAGGCTGCGGGG + Intergenic
1038001906 8:23399191-23399213 CATGGCAGTCACACCCTGGGTGG - Intronic
1038250847 8:25902962-25902984 CCTGGTAGGCAGAGGCTGAGTGG + Intronic
1038633681 8:29268613-29268635 CCTGGGAGGCAGAGGTTGCGCGG - Intergenic
1038963457 8:32547942-32547964 GCAGCCAGGCAGCGCCTGGGAGG - Intronic
1039596805 8:38797813-38797835 TCTGGCAGGAAGAGCAAGGGGGG - Intronic
1039983247 8:42427111-42427133 CTTGCCAGGCGGAGCCGGGGAGG + Intronic
1040388842 8:46932869-46932891 GCTGGAAGGCAGATCCTGGTGGG - Intergenic
1041291493 8:56312460-56312482 TCTGGCAGGCCGAGGCAGGGGGG + Intronic
1042107246 8:65341341-65341363 CCTGGGAGGTAGAACCCGGGAGG - Intergenic
1042557048 8:70042541-70042563 CCAGGCAGCCAGAGCCTGGAGGG + Intergenic
1044358722 8:91256973-91256995 CATGACAGACATAGCCTGGGTGG + Intronic
1044581136 8:93827469-93827491 CCTACCAGGCTCAGCCTGGGAGG + Intergenic
1044581135 8:93827469-93827491 CCTCCCAGGCTGAGCCTGGTAGG - Intergenic
1044739124 8:95307624-95307646 ACTGGATGGCAGAGCGTGGGAGG - Intergenic
1045059103 8:98396698-98396720 CCTGGGAGGCAGTGACTGGGTGG + Intergenic
1045373661 8:101549999-101550021 AGTGGCAGGCAGAGCTGGGGAGG + Intronic
1045425982 8:102066148-102066170 GCAGGCAGGCAAAGCCTGGAGGG + Intronic
1046720385 8:117612485-117612507 CCTGGGAGGCAGAGGTTGGGAGG - Intergenic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047687114 8:127315867-127315889 CCCGGGAGGCAGCGGCTGGGAGG + Intergenic
1048162358 8:132032829-132032851 ACTGGGAGGCTGAGCCTGGGGGG - Intronic
1048318891 8:133383234-133383256 TCTGGCCAGCAGAGCCTGGGAGG + Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1049277103 8:141725363-141725385 CCTGGCAGGCAGAGCCCAGCAGG - Intergenic
1049309010 8:141923570-141923592 CCTGCCAGGGAAAGCCAGGGAGG - Intergenic
1049487942 8:142876171-142876193 ATTGGCAGGCAGTGCCTGGGAGG + Intronic
1049492831 8:142914194-142914216 ATTGGCAGGCAGTGCCTGGGAGG + Intronic
1049511012 8:143026684-143026706 CCGTGCAGACAGAGCCTGGGAGG + Intergenic
1049514403 8:143045751-143045773 CCAGTCAGGAAGAGCCTGAGGGG - Intronic
1049519286 8:143080046-143080068 CCTGGCAGGGGTGGCCTGGGAGG - Intergenic
1049576607 8:143392654-143392676 CCTAGCAGCCAGAGCCAGGGAGG + Intergenic
1049580036 8:143406996-143407018 CCTGGCACCCACAGCCTGAGGGG + Intergenic
1049602507 8:143514405-143514427 GCTGGGAGGCAGGCCCTGGGTGG - Intronic
1049614220 8:143569182-143569204 CCTGGGAGGCGGGGCCTGGGAGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049720491 8:144113320-144113342 CCTGGCAGGCAGAGCTGGACTGG + Intronic
1049801726 8:144520868-144520890 ACAGACAGGCAGAGCCAGGGAGG - Intronic
1050175332 9:2864182-2864204 CTTGGAAGGCAGAGGATGGGAGG + Intergenic
1050472480 9:6007790-6007812 CCCGGCAGGCCTAGGCTGGGCGG + Intronic
1052707287 9:32008949-32008971 CAGGTCAGGCAGACCCTGGGTGG + Intergenic
1052757115 9:32552355-32552377 CCTGGCAGCCACCGCCTGGGAGG + Intronic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053014590 9:34654663-34654685 CCTGGCAGCCAGGGCAGGGGTGG + Intronic
1053313830 9:37035816-37035838 GCCGGGAGGCAGCGCCTGGGAGG + Intergenic
1053437984 9:38089937-38089959 TCTGGAAGGCCCAGCCTGGGTGG + Intergenic
1053484592 9:38442309-38442331 GATGGAAGGCAGAGCCTGTGGGG + Intergenic
1054459926 9:65457159-65457181 TCAGGGAGGCAGGGCCTGGGAGG - Intergenic
1055852089 9:80644247-80644269 CCTGGGAGGCTGAATCTGGGAGG - Intergenic
1055896490 9:81182535-81182557 CCTGGCAGAAATAGCCTGTGTGG + Intergenic
1055935213 9:81598359-81598381 CGTGGCAGGCAGAGGGAGGGAGG - Intronic
1056654429 9:88497407-88497429 CCTGGCAGTCACTGCCTGTGGGG - Intergenic
1056661728 9:88548591-88548613 GGTGGGAGGCTGAGCCTGGGAGG + Intronic
1057117626 9:92540693-92540715 CCTGGGAGGCAGAGGTTGTGGGG + Intronic
1058503838 9:105649060-105649082 GGAGGCAGGAAGAGCCTGGGAGG + Intergenic
1058547084 9:106072143-106072165 CCTGGAAGGCAGAGGTTGTGGGG + Intergenic
1058923676 9:109641077-109641099 CTTGGCTAGCAGGGCCTGGGGGG + Intronic
1059023274 9:110598844-110598866 CCTGGGATGGAGTGCCTGGGGGG - Intergenic
1059027304 9:110648921-110648943 CCTTGCAGGCAAAGCCAGGTGGG - Intergenic
1060823132 9:126672805-126672827 CCTGGCCAGCGGAGCCTGGCAGG + Intronic
1060845749 9:126836440-126836462 TCAGGCAGCCAGAGCCTGGGAGG + Exonic
1061234209 9:129333145-129333167 CCTGGGAGGCAGAGGCTGCGGGG - Intergenic
1061255303 9:129451723-129451745 CCAGGGAGGGAGGGCCTGGGGGG + Intergenic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1061724484 9:132574462-132574484 CCAAGCAGGCAGAGTCTGAGTGG + Intergenic
1061762327 9:132859342-132859364 CCTGGGAGGCTGAGCCTGGGAGG - Intronic
1061797825 9:133098558-133098580 CCAGCCAGCCAGACCCTGGGAGG + Exonic
1061965002 9:134008450-134008472 CCTGGAGGGCAAGGCCTGGGGGG - Intergenic
1061968126 9:134027551-134027573 CCTGGGAGGCTGAGTTTGGGAGG - Intergenic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062059310 9:134486419-134486441 CATGGAAGGCAGAGCCGGGCTGG + Intergenic
1062078186 9:134603572-134603594 CCTGGCAGGCAGGGCATCGTGGG + Intergenic
1062390737 9:136332734-136332756 CCTGGCAGGTAGTGGGTGGGAGG + Intronic
1062457402 9:136646136-136646158 CTTGTCAGCCAGAGCCTGGGTGG + Intergenic
1062469598 9:136696752-136696774 CCAGCCTGGCGGAGCCTGGGGGG + Intergenic
1062497899 9:136840231-136840253 CCTGGCAGGCCAGGACTGGGTGG + Intronic
1062573349 9:137195467-137195489 CTGTGCAGGCAGATCCTGGGTGG - Intronic
1062579047 9:137221596-137221618 CGGGGCAGGCAGGGGCTGGGTGG + Intergenic
1062718421 9:138022746-138022768 CCTGTCAGGAGGACCCTGGGGGG - Intronic
1185505617 X:630720-630742 CCAGACAGGCAGCGCATGGGGGG + Exonic
1185642714 X:1597440-1597462 CCTGGGAGGCGGTCCCTGGGAGG + Intronic
1185684493 X:1917287-1917309 CCTGGGAGGCAGAGGCGCGGTGG + Intergenic
1185879570 X:3729167-3729189 CTTGGGAGGCTGAGCCTGGGAGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1187269143 X:17764119-17764141 CCTGGCAGGCTGAGGCGGGAGGG + Intergenic
1188527172 X:31099338-31099360 CCAGGGAGGCATACCCTGGGAGG + Intronic
1188985123 X:36762228-36762250 CCTGATAGGCAGTGCCTGGGTGG - Intergenic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1189940639 X:46117420-46117442 CATTGCAGACAGAGCCTTGGTGG - Intergenic
1190431095 X:50378559-50378581 CCAGGTAGGCAGGGGCTGGGTGG - Exonic
1190740278 X:53284040-53284062 CCCAGCATGCAGAGCCTTGGAGG + Intronic
1190895566 X:54614546-54614568 CCAGGCAGGAATAGCCTGTGAGG + Intergenic
1191225686 X:58040547-58040569 CATTGCAGTCAGAGCCTTGGTGG + Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1194323513 X:92481198-92481220 CATTGCAGTCAGAGCCTTGGTGG - Intronic
1195174838 X:102305481-102305503 CGTGGCAGGCAAAGCCTTTGCGG + Intergenic
1195184027 X:102381612-102381634 CGTGGCAGGCAAAGCCTTTGCGG - Intronic
1195657738 X:107348419-107348441 CTTGCCTGGTAGAGCCTGGGTGG - Intergenic
1196031005 X:111096027-111096049 CCAGGCAGGAAGCGCCTGGGAGG - Intronic
1196659309 X:118253147-118253169 AGTGGCAGGCAGAGTCTTGGTGG - Intergenic
1197378895 X:125714083-125714105 CATTGCAGTCAGAGCCTTGGTGG + Intergenic
1198277058 X:135104974-135104996 GCAGGCAGGCAGAGCCTCAGTGG - Intergenic
1200161578 X:154012514-154012536 CCTGGGCGGCAGCACCTGGGAGG + Exonic
1200226158 X:154419058-154419080 GCTGGCAGCCAGGGCCTGGCTGG + Intronic
1200631615 Y:5594364-5594386 CATTGCAGTCAGAGCCTTGGTGG - Intronic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic