ID: 931649372 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:64454392-64454414 |
| Sequence | GCGCGCGCGCGCCCGGGGCC CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 756 | |||
| Summary | {0: 1, 1: 1, 2: 11, 3: 86, 4: 657} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 931649372_931649380 | 16 | Left | 931649372 | 2:64454392-64454414 | CCGGGCCCCGGGCGCGCGCGCGC | 0: 1 1: 1 2: 11 3: 86 4: 657 |
||
| Right | 931649380 | 2:64454431-64454453 | GCGCGCGCCCGCCGCCAGCTCGG | 0: 1 1: 1 2: 1 3: 18 4: 169 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 931649372 | Original CRISPR | GCGCGCGCGCGCCCGGGGCC CGG (reversed) | Exonic | ||