ID: 931649374

View in Genome Browser
Species Human (GRCh38)
Location 2:64454398-64454420
Sequence GGGCGCGCGCGCGCGCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 2, 2: 26, 3: 117, 4: 562}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931649374_931649380 10 Left 931649374 2:64454398-64454420 CCCGGGCGCGCGCGCGCGCGCCC 0: 1
1: 2
2: 26
3: 117
4: 562
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931649374 Original CRISPR GGGCGCGCGCGCGCGCGCCC GGG (reversed) Exonic
900180389 1:1308571-1308593 GCGCGCGCGCGGACGCGGCCTGG - Exonic
900180390 1:1308574-1308596 GGCCGCGTCCGCGCGCGCGCAGG + Exonic
901109854 1:6785686-6785708 GGGCGGGCGGGCGGGCGACCCGG + Intronic
901243006 1:7705510-7705532 GGGCGCGCGCGGGCGGGGCTGGG + Intronic
901243017 1:7705542-7705564 GGGCGCGCGGGGGCCCGGCCCGG + Intronic
901251666 1:7784163-7784185 GGGCGCGAGCCGGTGCGCCCGGG - Intergenic
901483136 1:9539755-9539777 GGGCGCGCGCGGCTGGGCCCGGG - Intronic
901489277 1:9588617-9588639 GGCCGCGCGGGGGCGCTCCCCGG + Intergenic
901628968 1:10639007-10639029 GGGCGCGGGCGCGCGGACCCCGG - Exonic
901641372 1:10694699-10694721 CGGCGCGGGCGCGCGCGGCGGGG - Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
902501446 1:16914148-16914170 GGGGGCGCGCGCGTGCGCGGGGG + Intronic
903263386 1:22142994-22143016 GGGCGCCCGCGGGCGGGCCGGGG + Intronic
903263437 1:22143158-22143180 GGGCGGGCGGGCGGGCGGCCGGG + Intronic
903349818 1:22710911-22710933 CGGGGCGCGCGCTCCCGCCCGGG + Intronic
903750273 1:25617017-25617039 GGGCGGGAGCCCGCGCTCCCGGG + Intergenic
903795121 1:25922923-25922945 GGGCGCGGCCGCGTGCGCCCGGG - Intergenic
904563389 1:31413316-31413338 GCGCGCGCGGGCGGGCGCCGGGG - Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
904769031 1:32870808-32870830 GGCCGCTCGCGCTCGCGCTCCGG + Exonic
904837733 1:33349842-33349864 GGTTGCGCGCGCGCGCGCGGCGG + Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
905803750 1:40861817-40861839 GGGGGCGCGGCCGCGCGGCCGGG + Exonic
906140362 1:43530831-43530853 GGGCGCGGGCGCGAGCGCGAGGG + Intronic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
906543248 1:46604200-46604222 GGGTGCGCGCGACCGCTCCCCGG - Exonic
907200928 1:52726413-52726435 AGGCGCGGGCTCGCGCGCCCGGG + Intergenic
907364282 1:53946318-53946340 AGGCGCGCGTGCGCGGGCCCCGG - Exonic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
910145647 1:84077827-84077849 GGGCACGCGAGCGCCAGCCCGGG + Intergenic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
911188555 1:94926802-94926824 GGGCGGGCGCGGGGGCCCCCGGG - Intronic
911601230 1:99850122-99850144 GGGCGAGTGCGCGCACGGCCAGG + Intronic
912363467 1:109113847-109113869 GCGCGGGAGAGCGCGCGCCCGGG - Exonic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915143924 1:153783561-153783583 GGGTTCGCGCGCGGCCGCCCCGG - Intergenic
916792508 1:168136702-168136724 TGGGGCGCGGGCGCGGGCCCGGG - Intronic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
920278839 1:204828599-204828621 GGGCGCGGGGGCGCGCACGCAGG + Intergenic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
921138655 1:212285378-212285400 GTGCGCGTGTGCGCGCGCCAGGG - Intergenic
922502892 1:226110084-226110106 GGGCGTGCGCGCGACCACCCGGG + Intergenic
922831531 1:228556784-228556806 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832009 1:228608738-228608760 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922832570 1:228610979-228611001 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833130 1:228613220-228613242 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922833691 1:228615461-228615483 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834250 1:228617702-228617724 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922834808 1:228619943-228619965 GCGCGGGTGCGAGCGCGCCCGGG - Intergenic
922835359 1:228622158-228622180 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922835918 1:228624378-228624400 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922836477 1:228626620-228626642 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837035 1:228628859-228628881 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922837594 1:228631101-228631123 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838153 1:228633342-228633364 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922838712 1:228635581-228635603 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839270 1:228637807-228637829 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922839829 1:228640048-228640070 GCGCGGGTGCGAGCGCGCCCGGG - Intergenic
922840392 1:228642279-228642301 GCGCGCGTGCGAGCGCGCCCGGG - Intergenic
922840952 1:228644520-228644542 GCGCGGGTGCGAGCGCGCCCGGG - Intergenic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923191709 1:231626668-231626690 GCGCGCGCGCGCGCGCGTCAGGG + Intronic
923372734 1:233328682-233328704 GGCCGGGCGCGCGCGGGTCCGGG - Exonic
923684142 1:236142402-236142424 CGGCCCGCGCGCCCCCGCCCCGG - Intergenic
923684145 1:236142405-236142427 GGGCGGGGGCGCGCGGGCCGGGG + Intergenic
923684153 1:236142422-236142444 GGCCCCGCGCGCCCCCGCCCCGG - Intergenic
924415377 1:243850955-243850977 CGGCGCGCGCGTCCGCGGCCAGG - Intronic
924527466 1:244864620-244864642 GGCCGAGCGCGGGCGCGCTCCGG - Intergenic
924706569 1:246507281-246507303 GGGCGCAGGCGCGCGGGTCCCGG - Intronic
1065025065 10:21534017-21534039 GGGCGCGGGGGCGCGCACGCGGG - Intergenic
1065025292 10:21534824-21534846 GGGCGCAGGCCGGCGCGCCCCGG - Intronic
1065099110 10:22316331-22316353 GGCCGCGCGCGCACGCGGCTCGG - Exonic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1065214701 10:23438881-23438903 CCGCGCGCGCTCGCGCGCCGAGG + Intergenic
1066464238 10:35639521-35639543 GGGCGGGGGCGCGGGCGCCACGG - Exonic
1066464396 10:35640319-35640341 GGGCGCGGGCGCGGGCGGCCCGG - Exonic
1066665673 10:37780698-37780720 GGGCACGTGCGCGCGCGTCCAGG - Intronic
1067769904 10:49115555-49115577 GCGGGCGCGAGCGCGGGCCCGGG - Intergenic
1068545078 10:58335444-58335466 GGGCCCGCGCGCGTTCGCGCCGG + Intronic
1069849532 10:71396426-71396448 GAGCGCCCGCTCGCCCGCCCGGG + Intergenic
1070257772 10:74826043-74826065 GGGCGCGGGCGGGCGCGCGCGGG - Intronic
1070800680 10:79243026-79243048 GGGAGGGCGCGCGCGAGCCGGGG + Intronic
1071997569 10:91163012-91163034 GTGCGCGAGCGCGCGCGCGTGGG - Intronic
1072994274 10:100229488-100229510 GGCCGGGCGCGGGCGGGCCCTGG - Exonic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076895382 10:133308918-133308940 GGCTGCGCCCGCCCGCGCCCGGG + Exonic
1077053162 11:576727-576749 GCGGGCGGGCGCGCGCGCGCTGG + Intronic
1077214620 11:1390237-1390259 GGGCGCCCGGGCGCGCGGGCAGG - Intronic
1077281621 11:1748634-1748656 GCGCGCCCGCGGGTGCGCCCCGG - Intronic
1077352068 11:2097633-2097655 GGGCGCCTGCCCGCCCGCCCTGG + Intergenic
1078210317 11:9265124-9265146 GGGCGGACGGGCGGGCGCCCGGG - Exonic
1080283593 11:30585375-30585397 CGGCGCGCGCGGGCGGCCCCGGG + Intronic
1081705609 11:45180752-45180774 GAGCCCGCCCGCGCCCGCCCCGG + Intronic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1082775670 11:57242597-57242619 GCGCGCACGCGCGCGTGCCTAGG - Intergenic
1082959571 11:58905788-58905810 GGGCGCACGCGCTCGCGGGCGGG - Intronic
1082959573 11:58905791-58905813 GCCCGCGAGCGCGTGCGCCCAGG + Intronic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1083753638 11:64777871-64777893 AGGGGCGCGCGTGCGCGCACGGG - Intronic
1083933232 11:65857372-65857394 CGGCGCGTGCGCGCACGCTCAGG - Intronic
1083970244 11:66070189-66070211 GGGCGCGAGCGCGCCCGGCCCGG + Intergenic
1084086289 11:66856843-66856865 GGGCGCGCGCGCCTGTGCCAGGG + Intronic
1084128982 11:67119128-67119150 GTGCGCGTTCACGCGCGCCCGGG + Intergenic
1084146151 11:67266426-67266448 CCGCCCGCGCGCCCGCGCCCCGG - Exonic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084171153 11:67401644-67401666 TGGCGCGCGGGCGGGCCCCCGGG - Intronic
1084295929 11:68213436-68213458 GGGCGCGGGGGCGGGCGCCGGGG - Intronic
1085641617 11:78196530-78196552 AGGCGAGCGCGCGGGGGCCCGGG - Exonic
1087003831 11:93449027-93449049 GTGCGCGCGTGCGCGCTCCTCGG + Intergenic
1087141439 11:94768887-94768909 GCGCGGGCGCGGGCGCGCCTCGG - Intronic
1087141441 11:94768892-94768914 GCGCGCCCGCGCCCGCGCGCGGG + Intronic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088820483 11:113452472-113452494 GCGCGCGCGCGCGCGCACATTGG + Intronic
1089397574 11:118145980-118146002 GGGGGCGCGCGGGCGCAGCCAGG + Intronic
1089729441 11:120511470-120511492 GGGCGCGGGTCCGCGCGGCCGGG - Intergenic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1091616201 12:2052922-2052944 GGGCGGGCGCGGGCGCGGCGGGG + Intronic
1092045941 12:5431977-5431999 GGGCGCGGGCGCGCGCGGCGCGG + Intergenic
1092196967 12:6555540-6555562 GGGCTCGCCCGCGCGCTCCCCGG - Exonic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1092899371 12:13044373-13044395 GGGCGCGCGCACGCGCACCGGGG + Exonic
1093435323 12:19129669-19129691 GGGCGCGCGCGGGGGCGCGCCGG + Intergenic
1093711725 12:22335312-22335334 GGGCGCGCGCGCACACACACGGG - Intronic
1093728722 12:22544264-22544286 GAGCGCGCGGGGGCGCGCGCGGG + Intronic
1094041710 12:26126101-26126123 GGGCGAGCGCGCGCGCGCACGGG - Intronic
1095180861 12:39145228-39145250 GGGCGCGCGCTTTCGCGCCGGGG - Intergenic
1095799390 12:46256594-46256616 GTGCGCGCGCGCGCGCAAACTGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096482395 12:51951536-51951558 GCGGGCGCCCGCGCGCGCCCCGG + Intergenic
1096482447 12:51951678-51951700 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
1096994618 12:55830812-55830834 GCGCGCGCGCGTGCGCGCGGTGG - Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098255373 12:68610828-68610850 GGGCGCGCGGGTGCGCGGCCCGG - Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1098369192 12:69739081-69739103 AGGCGGGCGCGCGGGCGCCGAGG - Intronic
1099890132 12:88580234-88580256 GGGCGCGCCCGGGAGCTCCCAGG - Intronic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100444744 12:94650308-94650330 CGGCGGGTGCGCGCGGGCCCGGG - Intronic
1100869398 12:98894871-98894893 GGGGGCGCGCGCGCGGGCCCGGG - Intronic
1101354716 12:103966119-103966141 TGGCGCGCGCGCGCGCACGCAGG + Intronic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101371943 12:104138299-104138321 GGGCGGGCGCGCGGGCGGCGCGG - Intergenic
1101641257 12:106586979-106587001 GTGCGCGCGCGCGGGCGAACGGG + Intronic
1102254098 12:111406184-111406206 GGGCGGGCGGGCCCCCGCCCTGG - Exonic
1103410778 12:120710349-120710371 GGGGGCGGGGGCGGGCGCCCGGG - Intergenic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1103800359 12:123533755-123533777 GGGAGGGCGCGCGCGTGCGCAGG + Intergenic
1103856369 12:123973246-123973268 GAGCGCGCGCGCGCGCGGCTCGG + Exonic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1104568285 12:129903899-129903921 GCTCGGGCGCGCGCGCGCTCCGG + Intergenic
1104841702 12:131828833-131828855 GGGCGAGCGCACGCGAGTCCTGG + Intronic
1104961407 12:132490089-132490111 GGGCGCGCGGGCGCCCGCGGCGG + Exonic
1105004227 12:132711021-132711043 GGGGGCGCGCGGCCGGGCCCCGG + Exonic
1105243564 13:18628485-18628507 GGGGACGCGCGCGCACGCTCGGG - Intergenic
1105541207 13:21319116-21319138 GGGATCGCGCGCGAGTGCCCAGG - Intergenic
1105964592 13:25372574-25372596 GGGCGCACGGGCACGCGCACAGG - Intronic
1106340127 13:28819830-28819852 GGGCGGGCAGGCGCGCGCGCAGG + Intergenic
1106735670 13:32586290-32586312 GGACGTGCGCGCGCGCGGACGGG + Intergenic
1107141103 13:36999347-36999369 GGAAGCGCGCCCGCGCGACCCGG + Exonic
1107359464 13:39603142-39603164 GTGGGCGCGCGCGGGCGCCGGGG + Exonic
1107654058 13:42574149-42574171 GGGCGCGCGGGCGAGCGGGCAGG - Exonic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1112216244 13:97434075-97434097 GGGCGCGCGCTCGAGCGCTGGGG + Intergenic
1112344269 13:98577072-98577094 CGGCCAGCGCGCGCGGGCCCAGG - Intronic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1113082522 13:106534396-106534418 GGGCCCGCGGGCGGGCGACCGGG - Intronic
1113082524 13:106534399-106534421 GGTCGCCCGCCCGCGGGCCCCGG + Intronic
1113473260 13:110561681-110561703 GGAAGCGCGTGTGCGCGCCCGGG + Exonic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113737709 13:112690157-112690179 GGGGCCGCGCGCGCGCGCTCTGG - Intergenic
1115545471 14:34462064-34462086 CGGCCCCCGCGCGCGCGGCCGGG + Intronic
1116186787 14:41608215-41608237 GTGCAAGTGCGCGCGCGCCCGGG + Exonic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121253097 14:92513946-92513968 GTCCCCGCGCGCGGGCGCCCCGG - Exonic
1122221334 14:100240375-100240397 GGGGGCGGGGGCGCGCGTCCCGG - Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122275120 14:100587200-100587222 GGGCGCGGGCGCGGGCGCGGAGG - Intronic
1122666678 14:103334696-103334718 CGGCGGGCGGGCGCGGGCCCGGG + Intronic
1122917333 14:104865210-104865232 GGGCGGGCGGGGGCGTGCCCGGG + Intergenic
1123040317 14:105487678-105487700 GGGCGCCCGGGATCGCGCCCCGG - Intronic
1123040323 14:105487705-105487727 GGGCGCGCGGGCGCGGGGCAGGG - Intronic
1123047546 14:105526352-105526374 GGGCGCCCTCGCGCACCCCCAGG - Intergenic
1124500791 15:30225234-30225256 GGGGGCTGGCGGGCGCGCCCAGG - Intergenic
1124500793 15:30225237-30225259 GGGCGCGCCCGCCAGCCCCCGGG + Intergenic
1124527563 15:30471208-30471230 TGGCAGGCGCGCGCGGGCCCCGG + Intergenic
1124640427 15:31393069-31393091 GGGCTCGCGCGCCCGCCTCCAGG - Intronic
1124742777 15:32313430-32313452 GGGCGCGCCCGCCAGCCCCCGGG - Intergenic
1124742779 15:32313433-32313455 GGGGGCTGGCGGGCGCGCCCAGG + Intergenic
1124771096 15:32536494-32536516 TGGCAGGCGCGCGCGGGCCCCGG - Intergenic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1127142679 15:55993578-55993600 GGACGCGCTCGCCCCCGCCCAGG + Intronic
1127415135 15:58749925-58749947 GGGCGCGCGCATGCGCGCGGGGG + Exonic
1127606600 15:60592760-60592782 GGGCGCCCGGGCGAGGGCCCGGG - Intronic
1127931645 15:63600988-63601010 CGGCGGGCGCGCGCGGGCGCGGG - Intronic
1127931647 15:63600991-63601013 GCGCCCGCGCGCGCCCGCCGCGG + Intronic
1128423972 15:67521185-67521207 TGGCGCGCAAGCGCGCCCCCGGG - Exonic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129051229 15:72783546-72783568 GGGCCCGCGCCTGCGCCCCCGGG - Exonic
1129082340 15:73052267-73052289 GCGTGCGCGTGTGCGCGCCCGGG + Intronic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1129612315 15:77070785-77070807 CGGCCCCCGCGCGCCCGCCCAGG + Intronic
1130002611 15:80060053-80060075 GCGCGCGGGCGCCCGCGGCCGGG + Intronic
1130348120 15:83067294-83067316 GCGCGCGCCCCCGCACGCCCGGG + Exonic
1130517041 15:84633608-84633630 AGGCTCGCGCGCCCGAGCCCGGG + Intergenic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131827070 15:96330567-96330589 CGGCGCGCGCGCGCCTGGCCAGG + Intronic
1132055547 15:98648493-98648515 GGGCGCGTGTGCGCGGGCCAGGG + Intergenic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1132552812 16:560363-560385 AGGCGGGCGCGCGTGCGCCTGGG - Intergenic
1133209221 16:4253854-4253876 TGGCGGGAGCGCGCGCGCCATGG + Intergenic
1133212803 16:4272578-4272600 GCGCACACGCGCGCCCGCCCGGG + Intronic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1136245796 16:28975119-28975141 GGCCGCGCCCGCCCGCGCTCCGG - Exonic
1137531760 16:49282403-49282425 GGGCGCGTGCGCGCGCGGCGGGG + Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138379297 16:56589337-56589359 GGGCGTGGGCGAGCGGGCCCCGG + Intronic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1139446296 16:67000742-67000764 ACGCGCCGGCGCGCGCGCCCGGG + Exonic
1139954270 16:70685861-70685883 GAGCGAGCGCCCGCGCGGCCTGG - Exonic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1140462249 16:75148966-75148988 GGGCGCGCGCGCGCGGGACGAGG + Intronic
1141054584 16:80803932-80803954 GGGAGCGGGCGCGGGCGCCGCGG + Intronic
1141068473 16:80932556-80932578 GGCCGCGCGCGCGCACACGCCGG + Intergenic
1141116612 16:81315015-81315037 GCGCGCGCGCCCGCCCGGCCCGG - Exonic
1141116613 16:81315018-81315040 GGCCGGGCGGGCGCGCGCGCAGG + Exonic
1141463339 16:84191355-84191377 GGGCGCGGGCGCGGGCCCCCAGG - Exonic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141828950 16:86498828-86498850 GGGTGCGCGCCTGAGCGCCCGGG - Intergenic
1142704230 17:1684410-1684432 GGGCGGGTGTGCGCGCGCGCAGG - Intronic
1142762268 17:2049741-2049763 GGACGCGCGCGCTCGAGCCTCGG + Intergenic
1142810699 17:2394252-2394274 GCGTGCGTGCGCGCGCGACCCGG - Intronic
1142863397 17:2776773-2776795 TGCCGCGCACGCGCGCACCCCGG - Intergenic
1143026617 17:3945020-3945042 GGACGCGCGGGCGGGCGGCCTGG - Intronic
1143172839 17:4939933-4939955 GGCCGCGCGCGCACGGGACCCGG - Exonic
1143183492 17:4997906-4997928 GGACGCGCGAGCGCGCGCGGAGG - Intergenic
1143482206 17:7234263-7234285 GGTCTCGCCCGCGCGCTCCCGGG + Exonic
1143495034 17:7307895-7307917 AGAGGCGCGGGCGCGCGCCCCGG + Intronic
1143783147 17:9239985-9240007 GGGCGGGCGGGCGGGCGCCAGGG + Exonic
1144656826 17:17042420-17042442 GGGCGGGCGGGCGGGCGGCCGGG - Intergenic
1144847047 17:18225560-18225582 GGGCGCGGGCGCGCGGGGCCGGG - Intergenic
1144847050 17:18225563-18225585 GGCCCCGCGCGCCCGCGCCCGGG + Intergenic
1144991568 17:19237351-19237373 GGACGCGTGCGCGCGCCCTCAGG - Exonic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146053290 17:29568616-29568638 GGAGGGGCGCGCGCGAGCCCAGG + Intronic
1146053316 17:29568695-29568717 GGGCGCGCGCGCTCCCTCGCTGG + Exonic
1146132713 17:30292220-30292242 GGGAGGGCGCCCGCGCGGCCCGG - Intergenic
1146132715 17:30292223-30292245 GGCCGCGCGGGCGCCCTCCCGGG + Intergenic
1147168680 17:38605987-38606009 GGGCGGGCGCGCGCGCGGCGCGG + Intergenic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147967247 17:44199827-44199849 CGGCACACGCGCGCGCGCTCCGG - Intronic
1148122770 17:45222316-45222338 GGGCGCGCGTCCCCGCCCCCGGG + Intronic
1148271730 17:46266925-46266947 GGCGGCGCGCGCGCGCGGCCGGG - Intergenic
1148284058 17:46372676-46372698 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148306279 17:46590597-46590619 GGGCGCGCGCGCGGGCTCGGCGG - Intergenic
1148807911 17:50273447-50273469 GGGCCTGCTCGCCCGCGCCCCGG + Intronic
1149475902 17:56960707-56960729 GGACGCGCCTGCGCACGCCCGGG - Intronic
1150802438 17:68292223-68292245 TGGAGGGTGCGCGCGCGCCCCGG - Intronic
1151625048 17:75271154-75271176 GGTGGCGCGCGCGCGTGCCCGGG + Exonic
1152245554 17:79183066-79183088 GGCCGAGCGCGGGGGCGCCCAGG - Intronic
1152356754 17:79811280-79811302 GCGTGCGCGTGCGCGCGCCTCGG - Intergenic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153457517 18:5296229-5296251 GCGCGCGCACGCGCGCGGCTTGG + Intronic
1153911278 18:9708343-9708365 GGGCGCGGGCGCGGCGGCCCCGG + Exonic
1153911306 18:9708474-9708496 GGGCGCGAGAGCGCGGGCCGGGG - Intronic
1154266517 18:12883704-12883726 GCGCTCGGGCGCGCGCCCCCGGG - Intronic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1155054496 18:22171793-22171815 GGCGGCGCGGGCGCGCACCCCGG + Exonic
1157279104 18:46334192-46334214 CGCCGCCCGCGCCCGCGCCCCGG + Intronic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1158505585 18:58044147-58044169 GGGGGCGCGTGTGCCCGCCCCGG + Intergenic
1158505698 18:58044486-58044508 GGGTGCCCGAGAGCGCGCCCTGG - Exonic
1160204518 18:76822323-76822345 GGGCGCGGGCGCGGGCGCGGTGG - Intergenic
1160204582 18:76822520-76822542 GGGCGCGCACGCGCGGGCACCGG - Intergenic
1160659592 19:291742-291764 GGGCGAGCGTGCGGGCGCCACGG + Intergenic
1160680340 19:409215-409237 GGGGGCGCGGGCGCGGGCGCGGG - Intergenic
1160719623 19:591462-591484 GGGCGTGCGCGTGTACGCCCGGG + Intronic
1160725442 19:616144-616166 GGGGGCTGGCGGGCGCGCCCGGG - Exonic
1160725445 19:616147-616169 GGGCGCGCCCGCCAGCCCCCGGG + Exonic
1160858719 19:1228728-1228750 GCGCGTGCGCGAGCTCGCCCGGG - Exonic
1160863931 19:1249109-1249131 GGCTGCGCCCGCGCGCGCTCGGG - Intronic
1160863934 19:1249112-1249134 GAGCGCGCGCGGGCGCAGCCGGG + Intronic
1160895883 19:1401590-1401612 GGACGCGCGCGCGCGGCTCCGGG + Intergenic
1161076941 19:2290392-2290414 GGCCGGGCGCGCGTGCTCCCCGG - Exonic
1161210411 19:3062566-3062588 GGGGGGGGACGCGCGCGCCCGGG + Intronic
1161248994 19:3270585-3270607 GGGTGCGCGCCTGTGCGCCCGGG + Intronic
1161461551 19:4400520-4400542 GCTCGCGCGCCCGCGCGGCCAGG + Exonic
1161461567 19:4400590-4400612 GGGGGCGCGCGCGGGGGCCGGGG - Intergenic
1161572001 19:5035887-5035909 GCGCGCGCGCCTGCGCGCACAGG + Intronic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1161840620 19:6678117-6678139 GGGCGGTCGCGCGCACGCGCAGG + Intronic
1161924958 19:7293585-7293607 GGGCGCGGAGGCGCGAGCCCGGG + Intronic
1162393827 19:10404892-10404914 GTCCGTGCGCGCGCGTGCCCGGG - Intronic
1162435234 19:10654302-10654324 GGGCGGGCAGGCGCGCGCCGGGG - Exonic
1162470804 19:10871276-10871298 GGGCGCGCGGGCACGCCCCTCGG - Intergenic
1162485962 19:10960847-10960869 GGACGGGCGCGCACGCGCGCCGG + Intergenic
1162486012 19:10961019-10961041 GCGCGCGCGCCCGCCCGCCTCGG - Exonic
1163369810 19:16895878-16895900 GCGCGCGCGCGCGCGCATACGGG - Intronic
1163597078 19:18226388-18226410 GGGCCCCCCCGCGCCCGCCCCGG - Intronic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1163804128 19:19385920-19385942 GGGGGTGCGCGTGCGCGCGCCGG - Exonic
1165080108 19:33302069-33302091 CGGGGCCCGCGGGCGCGCCCGGG + Exonic
1165349489 19:35268421-35268443 GGGCGGGCGCGCGCGAGCCCGGG - Intergenic
1165349924 19:35269726-35269748 GGGCGGGCGGGCGGGCGCGCCGG + Intronic
1166304192 19:41928391-41928413 GAGCGCGGGCGGGCGCGCGCCGG + Intronic
1166304194 19:41928393-41928415 GCGCGGGCGGGCGCGCGCCGGGG + Intronic
1166846754 19:45733327-45733349 GGCCGTGCGCACGCGCGCCTCGG - Exonic
1167018949 19:46860562-46860584 GGGCGAGCGCGCGTGCGCGGGGG - Intergenic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
1168408023 19:56120865-56120887 CCACGCGCACGCGCGCGCCCTGG + Intronic
1168408027 19:56120889-56120911 GGGTGCGCGTGCGCGGGTCCGGG - Intronic
1168408075 19:56121034-56121056 GGGCGCGCGTGCGCGCTGCTGGG - Intronic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
925370359 2:3340368-3340390 GGGCGGGCGCGCATGCTCCCTGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
928964936 2:36966688-36966710 GGGCGCGGGCTAGCGCGGCCCGG + Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929313571 2:40452155-40452177 GGGGGAGCGCGCGCGCGCCCGGG - Intronic
929578626 2:43068240-43068262 TGGTGGGCGAGCGCGCGCCCCGG + Intergenic
929776644 2:44934626-44934648 AGGCGCGCGCGCGCGCTTGCGGG - Intergenic
930872692 2:56184415-56184437 GCGCGCGCCCGCGCTCCCCCAGG - Exonic
930872694 2:56184420-56184442 GGGAGCGCGGGCGCGCGCGCGGG + Exonic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
932625674 2:73293758-73293780 GGGAGCGCGCGCGCACGCAGCGG - Intergenic
932680229 2:73818445-73818467 TGGTGGGCGCGCGCGCGCCCTGG + Intergenic
933206379 2:79512798-79512820 GGCCGCGGGCGCGCGCGGCCTGG - Intronic
935301661 2:101698144-101698166 GGGCCCGCGAGCGGGCGCGCGGG + Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
937221741 2:120346063-120346085 GCCCGCGCCCGCGCCCGCCCGGG - Intergenic
937221744 2:120346066-120346088 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
938301142 2:130213750-130213772 GGGCGCCCGCGCCCTCTCCCCGG + Intergenic
938397841 2:130963936-130963958 GGGCGCGCGAGCCCGGGCCGGGG - Intronic
941111605 2:161423516-161423538 CGGGGCCCGCGCCCGCGCCCGGG - Exonic
942034728 2:171999843-171999865 GGGAGCGCGCGTGCGCGCGCGGG - Exonic
942314093 2:174682585-174682607 GGGCGCGGGCGCGCGGCCTCGGG - Intronic
942748757 2:179264768-179264790 GCGCGACCCCGCGCGCGCCCGGG + Exonic
943342084 2:186693928-186693950 GGGCGCGGGACCGCGGGCCCCGG + Intergenic
944242616 2:197500324-197500346 GGGCGAGCGCGCCTGCGCGCTGG + Exonic
944675548 2:202032656-202032678 GGGCGCTCGCGCGCGCTCTCTGG - Intergenic
944683637 2:202098818-202098840 GTGCACGCGCGCGCGCGCGCAGG + Intronic
945203696 2:207310047-207310069 GTGCGCGCGCGCGCGCACGCAGG - Intergenic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
946231199 2:218292253-218292275 GGGCGCGCGGGTGGGCGGCCGGG - Intronic
946231201 2:218292256-218292278 GGCCGCCCACCCGCGCGCCCAGG + Intronic
946362821 2:219229347-219229369 GGGGGCGCGCGCGGGCGCCGGGG - Exonic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
947860645 2:233354902-233354924 GGGCGCGCAGGTGGGCGCCCCGG + Intronic
948874629 2:240820083-240820105 GGGCGCGGGCGCGGGAGGCCGGG + Intronic
948910139 2:240998719-240998741 GGGAGCGCGGGCGCGCCCGCTGG - Intergenic
949018177 2:241725294-241725316 GGGCGGGCGCGCGTGAGCTCGGG + Exonic
1168812017 20:710399-710421 GGGCGTGCGCGCGCGTGTCTGGG - Intergenic
1168965253 20:1894761-1894783 GAGCGCCCGCCTGCGCGCCCCGG - Intronic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1172109411 20:32536521-32536543 CGGCGCAGGCGCGTGCGCCCCGG + Intronic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1172703092 20:36864237-36864259 GGGGGAGCCCGAGCGCGCCCGGG - Intergenic
1173210720 20:41029357-41029379 GGCGGCGAGCGCGCGCGGCCGGG - Intronic
1173488412 20:43458294-43458316 GCGCGCGCACGTGCGCGTCCTGG + Intronic
1173582939 20:44160142-44160164 GGGCGCCCGCGCGGCCGCCTCGG + Exonic
1173662832 20:44745918-44745940 GGCCGAGCGTGCGCGCGGCCGGG + Exonic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1173827593 20:46057622-46057644 GGCCGGGCGCGCTCGGGCCCGGG - Exonic
1173856095 20:46251528-46251550 GGGGGCGCGGGCGGGCACCCCGG - Exonic
1174386794 20:50192115-50192137 GCGCGGGCGCGGGCGCTCCCCGG - Exonic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1174467865 20:50731430-50731452 GTGCGCGCGCGCGGGCTCGCGGG + Intergenic
1174607104 20:51768694-51768716 GGGGGCGCGGGCGCGGGCCGGGG - Intergenic
1175429606 20:58891952-58891974 GGGCTCGGGAGCGCGCGCCCGGG - Intronic
1175808069 20:61841765-61841787 GTGCGCGCGTGCGCGCACCGTGG + Intronic
1175847414 20:62065924-62065946 GGGGGCGGGGGCGCGCGGCCGGG + Intergenic
1175859549 20:62143095-62143117 GGGCGCCCGCGGGCGTGCGCGGG - Intronic
1175859795 20:62143931-62143953 GGGCGGGCGCGCGCGGGGACGGG + Intronic
1175911504 20:62407314-62407336 GGGCGCGCGGGCGCGCGGGCAGG - Intergenic
1175911505 20:62407318-62407340 CGGCGGGCGCGCGGGCGCGCGGG - Intergenic
1175992410 20:62796427-62796449 GGGCGGGCGCGCGCTCCGCCGGG - Intergenic
1175997170 20:62817069-62817091 CGGGGCGCACGCGCGCGGCCCGG - Exonic
1176131731 20:63499201-63499223 GGGCGCGGACGCGCGCGGGCGGG + Exonic
1176178537 20:63739520-63739542 GGGCGCGCGGGCGCGCGAGGTGG + Intronic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176547221 21:8207219-8207241 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176547801 21:8209002-8209024 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176547890 21:8209275-8209297 GCGGCCACGCGCGCGCGCCCCGG - Intergenic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176555126 21:8251428-8251450 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176555693 21:8253204-8253226 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176566172 21:8390266-8390288 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176566819 21:8392289-8392311 TGGCGCCCGCGGGCGCGCGCAGG - Intergenic
1176567882 21:8396419-8396441 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574046 21:8434452-8434474 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1176574627 21:8436236-8436258 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1176575786 21:8440638-8440660 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176611240 21:8987528-8987550 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1177077013 21:16588646-16588668 GTGCGCGCGCGTGCTCGCTCGGG + Intergenic
1177187970 21:17819119-17819141 GGGGGCGCGCGGCCGCCCCCAGG + Intronic
1178992267 21:37366367-37366389 GGGAGGCCGCGCGCGCTCCCCGG + Intronic
1179150536 21:38805512-38805534 GTGCGCGCGAGTGTGCGCCCTGG - Exonic
1179225086 21:39445829-39445851 GGGCGCGCGCATGCGCACTCGGG + Intergenic
1179444227 21:41420286-41420308 GGGGGCGCGGGCGCGGGCGCGGG + Intronic
1180215959 21:46324034-46324056 GGTCTCGCGCACGCGCGCTCTGG - Intergenic
1180791470 22:18577666-18577688 GCGTGGACGCGCGCGCGCCCGGG - Intergenic
1181230269 22:21417645-21417667 GCGTGGACGCGCGCGCGCCCGGG + Intronic
1181248381 22:21517218-21517240 GCGTGGACGCGCGCGCGCCCGGG - Intergenic
1181572020 22:23772891-23772913 GGGCGCGCGCGGCCGCGCTGCGG - Exonic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182435437 22:30326834-30326856 GGCCGCGCGCGCCCGCGGCCGGG - Exonic
1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG + Exonic
1183154744 22:36066307-36066329 GAGGGCGCGCGCGCACGGCCAGG + Intergenic
1183441357 22:37824894-37824916 GGACGCGCGCCGCCGCGCCCTGG + Exonic
1183504736 22:38202713-38202735 GTGTCCGCGCGCGCGCTCCCTGG + Intronic
1183649451 22:39145663-39145685 GGCCGCGCGCACGCACGCACGGG + Intronic
1183665689 22:39244558-39244580 GGGCGGGAGCGTGTGCGCCCTGG + Exonic
1183702384 22:39457681-39457703 GGGGGCGGGCGCGGGCGCACTGG + Intronic
1184023005 22:41833421-41833443 GGGTGGGCGCACGCGCACCCGGG - Intronic
1184086848 22:42270516-42270538 CGGCCCGCGCGCTCGCTCCCCGG + Intronic
1184523225 22:45007780-45007802 GGCCGCGCGCCCCCGCCCCCTGG - Intronic
1184712688 22:46262554-46262576 GGGCGATGGCGCGCGCGGCCGGG + Exonic
1185037914 22:48489412-48489434 GGGCGCGAGCGCGGGCGGCGCGG + Intergenic
1185351752 22:50343261-50343283 GGGCGCGCACGCTCGCGGCCGGG - Intergenic
1185387817 22:50544373-50544395 CAGCGCGCGCGAGCGCCCCCGGG - Intergenic
1185388443 22:50547047-50547069 GGCCGCGCGCGTGGGCGTCCAGG - Intergenic
1203252094 22_KI270733v1_random:123504-123526 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203252675 22_KI270733v1_random:125287-125309 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203260148 22_KI270733v1_random:168587-168609 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203260731 22_KI270733v1_random:170373-170395 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
951485252 3:23203110-23203132 GGGTGCGCGCGCGGACGGCCGGG + Intronic
951485297 3:23203271-23203293 GGGCGGGCGCGAGCGCGGCGGGG + Exonic
951558860 3:23946027-23946049 GGGGGCGCGCGCGCGCGCGCTGG + Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
952867067 3:37861655-37861677 GGCCGCGCGCGCGGGGGCCCGGG - Intergenic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
953748699 3:45594042-45594064 CGGCGCGCGGGCGGGCGCCCAGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954575002 3:51671140-51671162 GGGCGCGTGCGCGCGGGACCCGG - Intronic
954779040 3:53045938-53045960 GGGCGCGAGCGGGCGAGCGCGGG - Exonic
955060246 3:55487212-55487234 GGGCGCGGACGCGCGCGAGCCGG + Exonic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956605005 3:71065074-71065096 GGGCGCGCGGGCGCGGGGCGCGG - Intronic
956605006 3:71065077-71065099 CGCCCCGCGCCCGCGCGCCCCGG + Intronic
956761350 3:72447368-72447390 GGGCGCACGTGGCCGCGCCCGGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960702260 3:120450602-120450624 GGGCGGGTGGGCGCGCGTCCTGG - Intronic
961371729 3:126435613-126435635 GCGGGCCCGGGCGCGCGCCCAGG + Exonic
963160757 3:142149144-142149166 GGGCGCGGGCCCGCGCGCGGAGG - Intronic
963335713 3:143971974-143971996 GTGCGCGTGCGCGCGGGCACGGG + Exonic
963827312 3:149970287-149970309 GGGCTGGGGCGCGCGGGCCCCGG - Intronic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966449063 3:180037087-180037109 GGGCACGCGCGCGCGTTCCCAGG + Intergenic
966787716 3:183636008-183636030 GGGAGGGCGCGCGCGCCTCCTGG + Intronic
967904164 3:194486977-194486999 GGGGGAGCGCGCGCGGGCTCAGG + Intronic
968506449 4:973364-973386 GGCCGCGCGCGCCCGGGGCCGGG - Exonic
968584072 4:1407844-1407866 GAGCGCGCGGGCGCGTGCACCGG + Intergenic
968698230 4:2042812-2042834 GGGCGCTCACCCGCGCGTCCAGG - Exonic
968879833 4:3293165-3293187 GAGGGCGCGGGCGCGCGCCCCGG - Intronic
969344738 4:6563674-6563696 GGGCGCGTGAGCGCGGGCCCGGG + Intergenic
970332634 4:15002298-15002320 GAGGGCGCGCTCGCGCTCCCGGG - Intergenic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
975131848 4:70839409-70839431 GGGGGCGCGTGCACGCGGCCCGG + Intronic
975701981 4:77075641-77075663 GGGGGCGCGGGCGCGGGCGCTGG + Exonic
975778926 4:77819520-77819542 GCGCGCCCGCCCGCGAGCCCCGG - Intronic
975778927 4:77819523-77819545 GGGCTCGCGGGCGGGCGCGCAGG + Intronic
976199062 4:82561705-82561727 GGGCGGGCGGCCCCGCGCCCGGG + Intronic
976704520 4:88007429-88007451 GGGCGCCCGCGCCCGGGCTCCGG + Intergenic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
977908465 4:102502369-102502391 GCGCGCGCGCGCGCGCACGGAGG - Intronic
977937854 4:102827161-102827183 GGGCGCGCGCGGGAGCGCGCTGG - Intronic
978754261 4:112285827-112285849 GGCCGCGCGCGCGGGAGCGCGGG - Exonic
979205544 4:118033557-118033579 CGGCCCGCGCGCGCCCGCCCCGG - Intergenic
979582753 4:122379466-122379488 GGGCGCGGGGGCGCAAGCCCGGG + Intronic
979624102 4:122827022-122827044 GGGCGCGGCCGCGCGCTGCCGGG + Exonic
981093414 4:140756124-140756146 GGGCGGGCGCGCGTGTGCCCAGG - Intergenic
981604015 4:146522816-146522838 GAGCGGGCACCCGCGCGCCCAGG - Intergenic
981604016 4:146522819-146522841 GGGCGCGCGGGTGCCCGCTCTGG + Intergenic
984024118 4:174522522-174522544 GGCTGCACGCGCGCGCGCGCAGG - Exonic
984024119 4:174522525-174522547 GCGCGCGCGCGCGTGCAGCCCGG + Exonic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
984966383 4:185143600-185143622 GGGCGGGCGGGCGGGCGCCCGGG - Intronic
985629860 5:1008779-1008801 GAGCGCGTGCGCCCGCGCCGGGG - Intergenic
986233531 5:5887089-5887111 GGGAGCGCGCGGCCCCGCCCAGG + Intergenic
986330627 5:6713948-6713970 GGGCGGGCGCGCGGGCCCCGCGG + Intergenic
986330772 5:6714483-6714505 GGGCGCGGGGCCGCGCGGCCCGG - Intergenic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987303420 5:16617006-16617028 GCGCGCGCGCGGGCGCGCCTGGG + Exonic
989053319 5:37342878-37342900 GGGCTCGCGCCAGCACGCCCAGG + Intronic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
989178910 5:38556772-38556794 GGCCGCGCGCCCGCGCGCGCGGG + Intronic
991435921 5:66596871-66596893 CGGCGGGCGCCCGGGCGCCCAGG - Exonic
992286112 5:75236993-75237015 GAGGCCGCGCGCGCGCGCGCAGG + Intergenic
992487469 5:77210508-77210530 GGGCAGGCGGGCGGGCGCCCTGG + Intronic
992487598 5:77210889-77210911 GGGCGCGGGCGGGCGCGCGGGGG + Exonic
992796461 5:80258367-80258389 AGGCGCGCGCCACCGCGCCCGGG + Intergenic
993500513 5:88661045-88661067 GCGCCGGCGCGCGCGCTCCCGGG - Intergenic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
995623897 5:114056199-114056221 GCTCGCCCGCGCCCGCGCCCCGG + Intergenic
995853994 5:116574156-116574178 TGGGGCGCGCCCGGGCGCCCGGG + Intronic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997521389 5:134526352-134526374 GGGCGGGCGGGGGCGCGCCAGGG + Intronic
997564125 5:134874329-134874351 GGGGCCGCGCCCGCGCTCCCAGG + Exonic
997582966 5:135028714-135028736 GGGCGCGGGCGCGGGCGCGGAGG - Exonic
997704086 5:135930557-135930579 GGGCGCGAGCGCACGCCTCCCGG - Intronic
997704087 5:135930560-135930582 GGAGGCGTGCGCTCGCGCCCTGG + Intronic
997869990 5:137498594-137498616 GGGCGGGCGGCCGCGAGCCCCGG + Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998328673 5:141304363-141304385 AGGCGCGCGCCATCGCGCCCGGG - Intergenic
998583230 5:143402756-143402778 GCGCGCCCGAGCGCGAGCCCGGG - Intronic
998583232 5:143402759-143402781 GGGCTCGCGCTCGGGCGCGCCGG + Intronic
998849364 5:146338913-146338935 GAGCACGCCTGCGCGCGCCCGGG + Intronic
999129444 5:149271793-149271815 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
1002488760 5:179559098-179559120 GTAAACGCGCGCGCGCGCCCGGG + Intronic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1003427548 6:6007663-6007685 GCGAGCGCGCGCACACGCCCAGG + Intergenic
1004069728 6:12287754-12287776 AGGCGCGCGCGCGCGCGCGCAGG + Intergenic
1004193626 6:13486208-13486230 GGTTGTGCGCGCGCGCGCCTGGG - Intronic
1004216919 6:13711723-13711745 CGGAGCGCGGGCGCGCGGCCCGG + Intergenic
1004720445 6:18264216-18264238 GGGCGGGCGCGCGCGCACGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006136208 6:31897585-31897607 GCATGCCCGCGCGCGCGCCCGGG - Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006320678 6:33317652-33317674 GGGCCCGGGGGCGCGCGGCCCGG - Exonic
1006366761 6:33620911-33620933 GGGCGCGCCCTGGAGCGCCCTGG - Exonic
1007451313 6:41941776-41941798 CGGCGCGCGCGCGCGGGCGGCGG - Exonic
1010249879 6:73696313-73696335 GCGCGCGGGCGCGCGGGCCTGGG + Intronic
1011277200 6:85642968-85642990 GCGGGGGCGCGCGCGCGCACCGG - Exonic
1011640469 6:89412323-89412345 GAGCGCGCGCGCGCCCGTGCGGG - Intergenic
1012475745 6:99613632-99613654 GGCCGGGCGTGCGGGCGCCCCGG + Exonic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1012886513 6:104852227-104852249 GTGCGCGCGTGCGCGTGCACGGG + Intronic
1012916890 6:105180028-105180050 GGGCACGGGCGCGCGCCCCGGGG + Intergenic
1013576054 6:111483844-111483866 GGGCGCGCGGGCGCGGGCTTCGG + Intergenic
1014137629 6:117907505-117907527 GGGCGCGAGGGTGCGCGCACTGG + Exonic
1014798206 6:125749286-125749308 GGGCGCGCGGGGGCGGGCCCTGG - Intronic
1014802315 6:125790869-125790891 GGCCCCGCGGGCGCGCGCCTCGG + Exonic
1015366369 6:132401534-132401556 GGCCGGCCGCGCGCCCGCCCGGG + Exonic
1015626036 6:135181568-135181590 GGGGGCGCGCGGGGGCGCGCGGG + Intronic
1016340886 6:143060742-143060764 TGGCGCGGCCGCGAGCGCCCGGG - Intronic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1017163830 6:151390435-151390457 GCGAGCGCGCGCGCGCACGCGGG - Intronic
1017913944 6:158818370-158818392 GGGCGCGCGCCCCCGCTCTCGGG - Intronic
1018091134 6:160347914-160347936 AAGGACGCGCGCGCGCGCCCCGG - Intergenic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019473395 7:1232964-1232986 GGGCGCGGGGGCGCGGGCCGGGG - Exonic
1019711353 7:2519574-2519596 GGGCGTGCACGTGCGCGCCGGGG + Intronic
1020125230 7:5529743-5529765 GGGCGCGCGCCGGCGCCCCCTGG - Intronic
1020253004 7:6484192-6484214 TGCCCCGCGCGCGCGCGCGCCGG - Exonic
1022096339 7:27143849-27143871 GGGGGGTGGCGCGCGCGCCCCGG + Intronic
1022101203 7:27170030-27170052 GGGCGCAGGAGCGCGCGCCCCGG - Intronic
1022230748 7:28410062-28410084 GGGCGGGTGGGCGCGCGCGCAGG + Intronic
1022400043 7:30028362-30028384 GGACGCGCTCGCGCATGCCCAGG - Exonic
1022400044 7:30028365-30028387 GGGCATGCGCGAGCGCGTCCCGG + Exonic
1022715190 7:32892001-32892023 AGGCGCGCGCGCGCGCGAGGCGG - Intronic
1022923292 7:35037261-35037283 AGGGGCGCGCGCTCGGGCCCCGG + Intronic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1023972157 7:44999803-44999825 GCGCGCGCGGGAGCGCGCGCGGG - Intronic
1024394273 7:48848120-48848142 GGCCCCGCGCGCGCCCGCCGAGG + Intergenic
1024579752 7:50792721-50792743 GCGCGCGCGCCCGGGCGTCCGGG - Intronic
1024579755 7:50792729-50792751 GGGCCGCGGCGCGCGCGCCCGGG - Intronic
1026000350 7:66556272-66556294 GGGCGCGGGCGCGGGCGCGAGGG - Intergenic
1026934737 7:74247494-74247516 AGGCGTGCGCGGGCACGCCCAGG - Intronic
1027539919 7:79453725-79453747 GGGAACGCGCGCGCGCGCCTGGG + Intergenic
1029238819 7:99144110-99144132 CGGCGGGCGCGCGCGCGGCTCGG - Intergenic
1029438168 7:100573917-100573939 GGGCTCCCGCGGGCGCCCCCTGG + Intergenic
1029537004 7:101162965-101162987 GGGCGCGCGGGGGCGGGACCGGG + Exonic
1029640226 7:101815793-101815815 GGGGCCGCGCGCGCGAGGCCGGG + Intergenic
1031213281 7:118858667-118858689 GAGCGCGCGCGCGCGCGCGTGGG - Intergenic
1031886596 7:127251690-127251712 GGGCGTGGGCGCGGGCGCTCGGG - Intronic
1032298796 7:130668390-130668412 CGGGGCGCGCGCGGGCGCCGGGG + Intronic
1033589383 7:142797184-142797206 GGGCGCGGGCGCGGGCGGCTTGG + Intergenic
1034254063 7:149714900-149714922 GGGCGGGGGTGGGCGCGCCCGGG - Intronic
1034254102 7:149714988-149715010 GGTCGCGTGCGCCCGCGCCAGGG + Intronic
1034342713 7:150368678-150368700 TGGCGGGGGCGCCCGCGCCCCGG + Intronic
1034342714 7:150368684-150368706 GGGCGCCCGCGCCCCGGCCCCGG + Intronic
1035564599 8:633061-633083 GGGCCCGCGCGGGGCCGCCCAGG + Intronic
1036432242 8:8702085-8702107 GGGTCCGGGCGCGGGCGCCCAGG - Exonic
1036562228 8:9906847-9906869 CGGCGCGCGTGCCCGCGCCTGGG + Intergenic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036755374 8:11467601-11467623 CGGCGCCTGCGCGCACGCCCAGG - Intronic
1036910604 8:12754781-12754803 GGGCCAGCGCGAGCGGGCCCGGG - Exonic
1036930600 8:12951950-12951972 GGGAGCGCGCGCGCGGGCCGGGG - Intronic
1036930602 8:12951952-12951974 GGGGGAGCGCGCGCGCGGGCCGG - Intronic
1037769154 8:21788961-21788983 GGGCGCTGGCGCGAGAGCCCGGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039918362 8:41875995-41876017 GGACGTGCGCGCGCGGGGCCAGG - Intronic
1039936589 8:42051621-42051643 GGGCCCGCGAGCGCGGGGCCGGG + Intronic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1043148338 8:76682476-76682498 CGGCGCGGGCGCGGGCGCCGCGG + Intronic
1043388267 8:79768375-79768397 CGGCGCGCCCTCGCGCGGCCCGG - Intergenic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1044819279 8:96145000-96145022 GGGCCCGGGCGCGGGCGCCGAGG - Exonic
1044819326 8:96145175-96145197 GGGTCCCCGCGCGCGCGCCTCGG + Exonic
1047499343 8:125430020-125430042 GGACGCGCGCACACGCCCCCAGG - Intergenic
1047499344 8:125430023-125430045 GGGGGCGTGTGCGCGCGTCCAGG + Intergenic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1049109760 8:140635538-140635560 GGGCGGCCGCGCGCGCGCCACGG + Exonic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1050437853 9:5628956-5628978 GAGGGCCCGCGCGCGCGCTCTGG - Intergenic
1050437854 9:5628961-5628983 GCGCGCGCGCGGGCCCTCCCCGG + Intergenic
1050552130 9:6757949-6757971 CGGCGCGCGCGCCCTCGCGCAGG + Intronic
1051174364 9:14347883-14347905 CCGAGCGCGCGCGCGCGCCAGGG + Intronic
1053435129 9:38069178-38069200 GGGCACGGGCGCGCGGGCTCCGG - Exonic
1053435166 9:38069301-38069323 GGGCGCGCGAGCGGGCTCCGGGG - Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic
1057489561 9:95510846-95510868 AGCCGGGCGCGCGCGCGCACCGG - Intronic
1057490459 9:95516265-95516287 GGACCCGCGCTCCCGCGCCCAGG + Intronic
1057596134 9:96417687-96417709 CGGCGGGCGGGGGCGCGCCCCGG + Exonic
1057619104 9:96619418-96619440 CGGCGGGCGCGCGGGCGCGCGGG - Exonic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1058618774 9:106862432-106862454 AGGCGTGCGCGCTCGCGTCCCGG - Intergenic
1058618775 9:106862435-106862457 GGACGCGAGCGCGCACGCCTCGG + Intergenic
1059102501 9:111483930-111483952 GGGCGGGCGCGCGAGGGGCCCGG - Intronic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060200991 9:121651725-121651747 GGGCCCGTGTGAGCGCGCCCAGG + Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1060514576 9:124257917-124257939 GGGCGGGCGCGCGGGCGCGCGGG + Intronic
1061976101 9:134068537-134068559 GGGAGCGCGCGCGCGGGGCGGGG + Intergenic
1062220508 9:135412713-135412735 GGGGGCGAGCGCGCGCTTCCCGG - Intergenic
1062341365 9:136095154-136095176 TGGCGCGCGCGGCCGCCCCCGGG - Intronic
1062341433 9:136095379-136095401 GGCCGCGCGCGCGCGCGCACTGG + Intergenic
1062372228 9:136245868-136245890 GGGCGCGCGGGGGCGGGGCCGGG - Intergenic
1062621013 9:137422740-137422762 GGGCGCGCGCGCGTCCCACCGGG + Intronic
1203468497 Un_GL000220v1:106654-106676 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203469078 Un_GL000220v1:108438-108460 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203470237 Un_GL000220v1:112840-112862 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476318 Un_GL000220v1:150626-150648 GGTTGCGCGCACGCGCGCACCGG + Intergenic
1203476899 Un_GL000220v1:152410-152432 CGGCGCGCCCGCCCCCGCCCGGG - Intergenic
1203478058 Un_GL000220v1:156812-156834 GGGCGGGCGCGCGTACGCGCGGG - Intergenic
1185504799 X:624229-624251 GGGCTGGCGCGCGCGCGCGAGGG + Intergenic
1186669904 X:11758055-11758077 TGGCGCGCGCGCTCCCGCCCGGG - Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1187265002 X:17723769-17723791 GTGCGCGCGCGTGCGCGCATGGG + Intronic
1187341462 X:18425339-18425361 CGGCGCGCGCGTGAGCGCGCAGG + Intergenic
1187675770 X:21715310-21715332 ACGCGCGCGCGCTCGCGCGCTGG + Intronic
1195316844 X:103687494-103687516 GCACGCGCGCGCGCCCGCCGTGG - Intronic
1195316845 X:103687501-103687523 GGGCGCGCGCGCGTGCGTGATGG + Intronic
1195625179 X:106999822-106999844 GGACGCGCGCGCGGGCCCCTGGG - Intronic
1195954888 X:110318182-110318204 GGGCGCGCGCGCGCCGCTCCCGG + Exonic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1198636956 X:138711504-138711526 GGGGGAGCGCGCCCTCGCCCTGG + Exonic
1198767157 X:140091567-140091589 GGGCGGGCGCGCGGGCGGCGGGG - Intergenic
1199086454 X:143634724-143634746 GCGCGCGCGCACGCGAGCCGAGG - Intronic
1199445035 X:147911783-147911805 GCGCGCATGCGCGCGCTCCCAGG + Intergenic
1199760118 X:150898705-150898727 GCCCGCGCGCGCGCGCGGCGCGG + Exonic
1200128891 X:153830591-153830613 CGGCGCGCCCCCGCGCTCCCTGG - Intergenic
1200229436 X:154436839-154436861 GGGCGGGCGCGCGCGGGGCGGGG + Intergenic