ID: 931649380

View in Genome Browser
Species Human (GRCh38)
Location 2:64454431-64454453
Sequence GCGCGCGCCCGCCGCCAGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931649376_931649380 -10 Left 931649376 2:64454418-64454440 CCCCCTCGTGTGTGCGCGCGCCC 0: 1
1: 0
2: 0
3: 2
4: 73
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169
931649375_931649380 9 Left 931649375 2:64454399-64454421 CCGGGCGCGCGCGCGCGCGCCCC 0: 1
1: 2
2: 20
3: 139
4: 601
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169
931649370_931649380 27 Left 931649370 2:64454381-64454403 CCAGGTCGGCGCCGGGCCCCGGG 0: 1
1: 0
2: 0
3: 43
4: 341
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169
931649372_931649380 16 Left 931649372 2:64454392-64454414 CCGGGCCCCGGGCGCGCGCGCGC 0: 1
1: 1
2: 11
3: 86
4: 657
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169
931649374_931649380 10 Left 931649374 2:64454398-64454420 CCCGGGCGCGCGCGCGCGCGCCC 0: 1
1: 2
2: 26
3: 117
4: 562
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169
931649373_931649380 11 Left 931649373 2:64454397-64454419 CCCCGGGCGCGCGCGCGCGCGCC 0: 1
1: 2
2: 24
3: 111
4: 532
Right 931649380 2:64454431-64454453 GCGCGCGCCCGCCGCCAGCTCGG 0: 1
1: 1
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931649380 Original CRISPR GCGCGCGCCCGCCGCCAGCT CGG Exonic