ID: 931652713

View in Genome Browser
Species Human (GRCh38)
Location 2:64482983-64483005
Sequence GGTGTGATGACTCCAACATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931652713_931652716 -2 Left 931652713 2:64482983-64483005 CCTGATGTTGGAGTCATCACACC No data
Right 931652716 2:64483004-64483026 CCCCACCAGCAGGAACGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931652713 Original CRISPR GGTGTGATGACTCCAACATC AGG (reversed) Intergenic
No off target data available for this crispr