ID: 931653083

View in Genome Browser
Species Human (GRCh38)
Location 2:64486191-64486213
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931653078_931653083 27 Left 931653078 2:64486141-64486163 CCTGTGTTAACGGGTGCGGTGCT No data
Right 931653083 2:64486191-64486213 AGTAAACACAAAGGTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type