ID: 931653083 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:64486191-64486213 |
Sequence | AGTAAACACAAAGGTTGCCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
931653078_931653083 | 27 | Left | 931653078 | 2:64486141-64486163 | CCTGTGTTAACGGGTGCGGTGCT | No data | ||
Right | 931653083 | 2:64486191-64486213 | AGTAAACACAAAGGTTGCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
931653083 | Original CRISPR | AGTAAACACAAAGGTTGCCT GGG | Intergenic | ||