ID: 931653397

View in Genome Browser
Species Human (GRCh38)
Location 2:64488808-64488830
Sequence GCTGCTGCTGCGATGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931653397_931653403 20 Left 931653397 2:64488808-64488830 CCCAGACTCATCGCAGCAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 131
Right 931653403 2:64488851-64488873 TTCTCAGGTTTGAAAGGCGCTGG No data
931653397_931653400 -10 Left 931653397 2:64488808-64488830 CCCAGACTCATCGCAGCAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 131
Right 931653400 2:64488821-64488843 CAGCAGCAGCATCTAGGAACAGG 0: 1
1: 0
2: 2
3: 40
4: 264
931653397_931653404 21 Left 931653397 2:64488808-64488830 CCCAGACTCATCGCAGCAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 131
Right 931653404 2:64488852-64488874 TCTCAGGTTTGAAAGGCGCTGGG No data
931653397_931653405 28 Left 931653397 2:64488808-64488830 CCCAGACTCATCGCAGCAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 131
Right 931653405 2:64488859-64488881 TTTGAAAGGCGCTGGGTGTGAGG No data
931653397_931653402 14 Left 931653397 2:64488808-64488830 CCCAGACTCATCGCAGCAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 131
Right 931653402 2:64488845-64488867 AACACATTCTCAGGTTTGAAAGG No data
931653397_931653401 5 Left 931653397 2:64488808-64488830 CCCAGACTCATCGCAGCAGCAGC 0: 1
1: 0
2: 2
3: 19
4: 131
Right 931653401 2:64488836-64488858 GGAACAGGTAACACATTCTCAGG 0: 1
1: 0
2: 1
3: 18
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931653397 Original CRISPR GCTGCTGCTGCGATGAGTCT GGG (reversed) Intergenic
900245823 1:1635680-1635702 GCTGGAGCTGCGATGAGACTCGG - Exonic
900257048 1:1702823-1702845 GCTGGAGCTGCGATGAGACTCGG - Intronic
900288291 1:1912503-1912525 ACTGCTGCTGCAATGAATATGGG - Intergenic
900694213 1:4000109-4000131 GCTGCAGCTGCTCTGAGTCCAGG + Intergenic
901166421 1:7224875-7224897 GCTGCTGCCCTGATGAGTCTCGG + Intronic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
903059976 1:20662693-20662715 GAGGCTGCTGAGATGAGTGTAGG - Intergenic
905381006 1:37561600-37561622 GCTGCTGCTGCTGCGAGTCCGGG + Exonic
907116627 1:51974453-51974475 GATGCTGATGCCATGGGTCTGGG + Intronic
908747161 1:67386725-67386747 GCTGTTGCTGCCATGGGTCAGGG + Intronic
915066346 1:153228182-153228204 GCTGCTGCTGCACAGAGACTTGG - Intergenic
916155386 1:161840389-161840411 GCTGCTGCTGCTCTGTGGCTTGG - Intronic
916278578 1:163023545-163023567 CCTGATGCTGGGATGAGCCTGGG + Intergenic
920091103 1:203453821-203453843 CCTGCTCCTGCGGGGAGTCTGGG - Intergenic
920420817 1:205832142-205832164 GGTGCTGCTGGGATTGGTCTGGG + Intronic
921053603 1:211527916-211527938 GGTGCTGCTGGGATCAGTCATGG - Intergenic
921905173 1:220488427-220488449 GCTGCTTTTGCCCTGAGTCTCGG - Intergenic
922804118 1:228376973-228376995 GCTCCTGCTGCTCTGAGTGTTGG + Intronic
923778348 1:236999482-236999504 GCTGCTGCTGCCGTGAGTTAAGG + Intergenic
1065579414 10:27155694-27155716 GTTGCTGGAGCGAGGAGTCTGGG + Intronic
1067191340 10:44070691-44070713 GGTGCTGCTGTAGTGAGTCTAGG + Intergenic
1068060813 10:52064824-52064846 GCTGCTGCTGCCATCACACTGGG - Intronic
1074476684 10:113780787-113780809 GGTTCTGCTGCCATGGGTCTGGG - Intronic
1075259414 10:120949709-120949731 CCTGCTGCGGAGATGAGTCCAGG - Intergenic
1080304945 11:30826056-30826078 GCTGCTGCTGCTCTGAGTCTGGG + Intergenic
1080404053 11:31962923-31962945 AATGCTGCTGCTATGAGTGTAGG + Intronic
1080556483 11:33421961-33421983 GCTGCTGCTGCTATTGGTCTGGG + Intergenic
1080780270 11:35422750-35422772 GCTGCTGTTCCCATGTGTCTAGG - Intergenic
1082679580 11:56152097-56152119 GCTGCTGCAGATATGAGTGTAGG + Intergenic
1082889917 11:58127659-58127681 CCTGCAGCTGCTATGAGTATTGG - Intronic
1084693318 11:70739386-70739408 GCAGCTGCTGCGGTGAGGCCAGG + Intronic
1085266591 11:75241163-75241185 GCTGCTGCTGCGCTGCGCGTCGG + Exonic
1085296916 11:75436535-75436557 GCTGCTGCTTCCATCAGACTGGG + Intronic
1089857982 11:121563793-121563815 GTTGCTCCTGCGATGGCTCTTGG + Intronic
1090620006 11:128552034-128552056 GTTTCTGCTTCGATAAGTCTGGG + Intronic
1093029679 12:14276727-14276749 GTTGAGGCTGCAATGAGTCTGGG - Intergenic
1094375978 12:29787653-29787675 GCTTCTGCTGCCACCAGTCTGGG - Intergenic
1096623370 12:52878341-52878363 GCTGCAGCTGCAGTGAGCCTTGG + Intergenic
1097187995 12:57205793-57205815 GCAGCTGCAACTATGAGTCTGGG - Intronic
1098991915 12:77072967-77072989 GCTGCTACTGCCATCAGTCTGGG + Intergenic
1099985455 12:89657747-89657769 GATGCTGATGCTATCAGTCTAGG + Intronic
1100329518 12:93571048-93571070 GCGGCGGCTGCGACGAGACTTGG - Intronic
1105068121 12:133217453-133217475 GCTGCTTCTGCCCTGAGTCTGGG + Intergenic
1106838948 13:33666030-33666052 GCTGCTGCTAACATGAGACTAGG + Intergenic
1113516672 13:110908115-110908137 GCTGTGGCTGCGATGTGACTGGG - Intronic
1113540124 13:111100732-111100754 GCTGCTGCTGCGCTGAGTTCAGG - Intergenic
1115440953 14:33434959-33434981 TCTGCTGCTGCTATGTGTATAGG - Intronic
1118628924 14:67685451-67685473 GCTGCTGAGAGGATGAGTCTTGG - Intronic
1121033861 14:90682809-90682831 GCAGCTGCTGCGCTGAGAATGGG + Intronic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1121173636 14:91874286-91874308 GCTACTGCTGCAAGGAGGCTGGG - Intronic
1121739946 14:96244555-96244577 GCTGCTGCGCCTATGATTCTAGG - Intronic
1122707292 14:103629267-103629289 GCTGCTGGTGCGAGGAGCCGCGG + Intronic
1122732183 14:103808909-103808931 GGTGCTGCTGCGCTCAGCCTGGG - Intronic
1122814660 14:104306589-104306611 GCTGCTTCTGCCATGAGGCCTGG + Intergenic
1125127013 15:36236376-36236398 GCTGCTTCTCCAATAAGTCTTGG - Intergenic
1127289365 15:57556674-57556696 GCTGCTGTTGCTATGGGTCATGG + Intergenic
1128239844 15:66094391-66094413 ACTGCTCCAGCGGTGAGTCTGGG - Exonic
1131584803 15:93681589-93681611 GCTGCAGCTGCCATGAGCCAGGG + Intergenic
1132102603 15:99035324-99035346 GTTGCTGCAGCCAGGAGTCTAGG + Intergenic
1132574726 16:659152-659174 GCAGGTGCTGCGCTGACTCTGGG + Intronic
1132723809 16:1330213-1330235 GCCCCTGCTGCGGTGAGGCTTGG - Intergenic
1133144058 16:3770605-3770627 GCTGTTGCTGCGATGACTGAGGG + Exonic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1140186160 16:72774220-72774242 GCTGCTGCTGCCCTGTGTTTCGG + Intergenic
1141404213 16:83777405-83777427 CCTGCAGCTGCGCTGAGTCTTGG + Intronic
1142412744 16:89924516-89924538 GCTGGTGCAGCGCTGATTCTGGG + Intronic
1143233618 17:5379004-5379026 GCTGCTGATGCCACGAGACTTGG + Intronic
1148189592 17:45669258-45669280 GCTGCTGCTGCTGTGAGTTTTGG + Intergenic
1150805886 17:68318755-68318777 GCTGCTGCTGCTAGGAGTTACGG + Intronic
1152105968 17:78329402-78329424 GGTGCTGCTGGGAGGACTCTGGG + Intergenic
1160337887 18:78059170-78059192 CCTGCTGCTGGGAAGAGTCAAGG - Intergenic
1165433988 19:35786984-35787006 CCTGCTGCTGCGAGGAGCCGAGG + Exonic
1166782680 19:45350636-45350658 GCTGCTGCGGCGAAGGGCCTGGG - Exonic
1167157957 19:47750692-47750714 GCTGTTGCTTCGTTGAGTCTGGG + Intronic
1168607233 19:57769834-57769856 GCTGCTGCCGCCATGACTCTGGG - Exonic
926205541 2:10832539-10832561 GCTGCTGCGGGGATGCGTGTGGG + Intronic
928097265 2:28412369-28412391 ACTGCTTCTGCGGTGAGCCTTGG - Exonic
931653397 2:64488808-64488830 GCTGCTGCTGCGATGAGTCTGGG - Intergenic
931894725 2:66716319-66716341 GCCTCTGCTGCGCTGGGTCTGGG + Intergenic
935672044 2:105564278-105564300 GCTGCTGCTGCGCTGGGCTTCGG - Intergenic
938122374 2:128643004-128643026 GCTGCTGCTGCTGTGACTGTTGG - Intergenic
938447360 2:131389288-131389310 GCTGCCACTGCTCTGAGTCTGGG + Intergenic
943356573 2:186863625-186863647 GCTGATGTTGAGATGAGTCAAGG - Intergenic
945384532 2:209181048-209181070 GATGCTGCAGCCATGAGTCTGGG - Intergenic
947448124 2:230180106-230180128 GCTGCAGCAGCGGTGAGTTTAGG + Intronic
948894297 2:240921189-240921211 GCTGGTGCTGCCATGATCCTGGG - Intronic
1168935355 20:1660755-1660777 GCACCTGCTGTGATGAGTCAGGG - Intergenic
1169335264 20:4750687-4750709 CCTCCTGCTGGGATGAGACTGGG + Intergenic
1170850146 20:19997273-19997295 GCTGCTGCTGCTGAGATTCTGGG - Intronic
1170900546 20:20458044-20458066 GCTGATGCTCCGAGGAGACTGGG + Intronic
1171380846 20:24732894-24732916 GCTGCTGCTCTGAGGAGTGTAGG + Intergenic
1172118508 20:32584854-32584876 GCTGCTGCTGCGCGGGGGCTGGG - Intronic
1179150761 21:38806256-38806278 GCGGCTGCTGCGAGGACTCTAGG + Intronic
1181986127 22:26800898-26800920 GCTGCTGCTGCTCTGTGGCTGGG + Intergenic
1182304192 22:29356557-29356579 GTTGCTGCTGGGGTGAGACTCGG + Exonic
1182742157 22:32575735-32575757 GCTGCTGCTAAAATGACTCTGGG + Intronic
1183937860 22:41274100-41274122 GCCTCTGCTGCGAGGAGTGTAGG + Intronic
952898568 3:38095269-38095291 GCTGCAGATGGGGTGAGTCTGGG - Intronic
957061062 3:75481702-75481724 GCTCCTGCTGCGTTGGCTCTGGG + Intergenic
957482501 3:80816464-80816486 GCTGCTGCTGAGATGAGAGAAGG + Intergenic
962862259 3:139414870-139414892 GCTGCTGCAGGTATGAGTGTAGG - Intergenic
965690178 3:171347622-171347644 GCTGCTGCTCCGATGACTCCTGG - Intronic
969597775 4:8158679-8158701 GCGGCTGCTGAGATGAGTGCAGG - Exonic
971457819 4:26860853-26860875 GCTGCTGCTGCGGCGAGACCGGG - Exonic
975459286 4:74631513-74631535 GCTGCTACTCTGATGACTCTAGG - Intergenic
976703025 4:87991835-87991857 ACTGCTCCTGCAAGGAGTCTAGG - Intergenic
981337187 4:143581048-143581070 GCTCCTGCTGCGCTCAGGCTTGG + Intronic
981364654 4:143888347-143888369 GCAGCTGCTGCTTTGAGTTTTGG + Intronic
981385770 4:144128820-144128842 GCAGCTGCTGCTTTGAGTTTTGG + Intronic
985558252 5:568676-568698 GGAGCTGCCGCGATGTGTCTGGG - Intergenic
986131430 5:4935685-4935707 GCTAGTGCTGCAATGAGTGTGGG - Intergenic
986132197 5:4942219-4942241 GCGGGTGCTGCGATGGGACTTGG - Intergenic
990399625 5:55425076-55425098 TCTGCTGCTGCTATGCCTCTTGG - Exonic
992747234 5:79831671-79831693 GCTGCTGCAGCCATGAGTCAGGG + Intergenic
997298603 5:132785654-132785676 GCTGCTGCTGGGAGGAATCCAGG + Intronic
998094533 5:139389811-139389833 GCTGCTGCTGCTGGGAGCCTGGG - Exonic
1001454876 5:171852851-171852873 AATGCTGCTGGGATGGGTCTGGG + Intergenic
1002106384 5:176881291-176881313 GCTGCACCCGCGGTGAGTCTGGG - Exonic
1002699845 5:181115126-181115148 GCTGCTGCGTGGATGAGTCTAGG + Intergenic
1008616967 6:53235867-53235889 GGTGATGCTGCGAAGAGACTGGG - Intergenic
1018529330 6:164745816-164745838 GCTGCTTCTGCTATGATTTTAGG - Intergenic
1019294560 7:266972-266994 GCTGCTGCTGTGTGGGGTCTGGG + Intergenic
1019748814 7:2716116-2716138 GCTGTGTGTGCGATGAGTCTGGG + Exonic
1019926368 7:4195821-4195843 GCTGCTGCTGCCGAGAGGCTGGG - Intronic
1024984256 7:55181948-55181970 GCTGCTGCTGCTATGTGGCTGGG + Intronic
1027233602 7:76285552-76285574 GCCGCTGCTGGGATGGGGCTCGG + Intronic
1027247211 7:76375339-76375361 GCAGCTTCTGGGATGAGTCTGGG - Intergenic
1028017679 7:85735953-85735975 GCTGCTGCTCTTCTGAGTCTAGG - Intergenic
1028077482 7:86534204-86534226 GCTCCTGCTGCCCTCAGTCTGGG - Intergenic
1028949674 7:96620350-96620372 GCTGCTGCTGCACTGATTCTAGG - Intronic
1037666230 8:20972525-20972547 GCTGAGGCTGCGATGGGTCCAGG + Intergenic
1037676389 8:21054451-21054473 GCTGCTACTGTGATGAGAGTTGG - Intergenic
1037700767 8:21271985-21272007 GCTGCTGCAAGGATGAGCCTGGG + Intergenic
1042175260 8:66032283-66032305 CCTGCTGCTGCCCTGAGTGTTGG - Intronic
1044888656 8:96808315-96808337 GCTGCAGCTGCCAGGTGTCTAGG + Intronic
1045779823 8:105849796-105849818 GCTGCTGCTGCTATGGGGGTTGG - Intergenic
1048389845 8:133952297-133952319 GCTGCAGCTGAGATGAAGCTGGG + Intergenic
1049337830 8:142095945-142095967 GCTGCTGCTGCGGAGAGGGTGGG + Intergenic
1049657460 8:143805101-143805123 GCTGGTGATGCGGTGAGGCTGGG - Exonic
1052142404 9:25003805-25003827 GCTGCTGCTGCCTTTGGTCTAGG - Intergenic
1056798467 9:89675144-89675166 GCTGCTGATGGGAGGAGTCCTGG + Intergenic
1187966211 X:24614931-24614953 GCTGCTGCTGCTACTAGTCCTGG - Intronic
1188849042 X:35109874-35109896 GTTGATGCTGCAATGAGTTTAGG - Intergenic
1189336847 X:40175641-40175663 GCGGGTGCTGCGCGGAGTCTAGG - Intronic
1189408677 X:40749774-40749796 GCTGCTGCTGAGATGGCTCAGGG - Intergenic
1189992814 X:46610613-46610635 GCTGCTGCTGCTTTGAGCCGGGG - Intronic
1196856750 X:119991530-119991552 GCTGCTGCTGCGAGGGCTCCTGG - Intergenic
1196899072 X:120365591-120365613 TCTGCTGCTGCAATAAGCCTTGG + Intronic
1197977973 X:132185384-132185406 CCTGCTTCAACGATGAGTCTTGG + Intergenic
1198394221 X:136206644-136206666 GCTGCTGCTGCCATGGTTGTGGG - Intronic
1198509135 X:137331493-137331515 GCTGCTGCTGTTATAAGTCCTGG - Intergenic
1201934698 Y:19395962-19395984 GCTGCTGCTGCTATGGGGATGGG + Intergenic