ID: 931655422

View in Genome Browser
Species Human (GRCh38)
Location 2:64506964-64506986
Sequence ATTTTTTTAAGGTATGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931655422_931655427 18 Left 931655422 2:64506964-64506986 CCCATTTCATACCTTAAAAAAAT No data
Right 931655427 2:64507005-64507027 TGTTATCAAGATGCTAACATTGG No data
931655422_931655428 24 Left 931655422 2:64506964-64506986 CCCATTTCATACCTTAAAAAAAT No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931655422 Original CRISPR ATTTTTTTAAGGTATGAAAT GGG (reversed) Intergenic
No off target data available for this crispr