ID: 931655425

View in Genome Browser
Species Human (GRCh38)
Location 2:64506975-64506997
Sequence TCCTGTGGTGTATTTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931655425_931655427 7 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655427 2:64507005-64507027 TGTTATCAAGATGCTAACATTGG No data
931655425_931655428 13 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data
931655425_931655430 25 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655430 2:64507023-64507045 ATTGGTAATGGCTGAGAAGGTGG No data
931655425_931655429 22 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655429 2:64507020-64507042 AACATTGGTAATGGCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931655425 Original CRISPR TCCTGTGGTGTATTTTTTTA AGG (reversed) Intergenic
No off target data available for this crispr