ID: 931655426

View in Genome Browser
Species Human (GRCh38)
Location 2:64506990-64507012
Sequence TGATAACATAAAAATTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931655426_931655428 -2 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data
931655426_931655431 24 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655431 2:64507037-64507059 AGAAGGTGGAATTGTGTATTTGG No data
931655426_931655433 26 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655433 2:64507039-64507061 AAGGTGGAATTGTGTATTTGGGG No data
931655426_931655427 -8 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655427 2:64507005-64507027 TGTTATCAAGATGCTAACATTGG No data
931655426_931655430 10 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655430 2:64507023-64507045 ATTGGTAATGGCTGAGAAGGTGG No data
931655426_931655429 7 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655429 2:64507020-64507042 AACATTGGTAATGGCTGAGAAGG No data
931655426_931655434 30 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655434 2:64507043-64507065 TGGAATTGTGTATTTGGGGTAGG No data
931655426_931655432 25 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655432 2:64507038-64507060 GAAGGTGGAATTGTGTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931655426 Original CRISPR TGATAACATAAAAATTCCTG TGG (reversed) Intergenic
No off target data available for this crispr