ID: 931655428

View in Genome Browser
Species Human (GRCh38)
Location 2:64507011-64507033
Sequence CAAGATGCTAACATTGGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931655423_931655428 23 Left 931655423 2:64506965-64506987 CCATTTCATACCTTAAAAAAATA No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data
931655425_931655428 13 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data
931655422_931655428 24 Left 931655422 2:64506964-64506986 CCCATTTCATACCTTAAAAAAAT No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data
931655426_931655428 -2 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655428 2:64507011-64507033 CAAGATGCTAACATTGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931655428 Original CRISPR CAAGATGCTAACATTGGTAA TGG Intergenic
No off target data available for this crispr