ID: 931655429

View in Genome Browser
Species Human (GRCh38)
Location 2:64507020-64507042
Sequence AACATTGGTAATGGCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931655425_931655429 22 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655429 2:64507020-64507042 AACATTGGTAATGGCTGAGAAGG No data
931655426_931655429 7 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655429 2:64507020-64507042 AACATTGGTAATGGCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931655429 Original CRISPR AACATTGGTAATGGCTGAGA AGG Intergenic
No off target data available for this crispr