ID: 931655430

View in Genome Browser
Species Human (GRCh38)
Location 2:64507023-64507045
Sequence ATTGGTAATGGCTGAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931655425_931655430 25 Left 931655425 2:64506975-64506997 CCTTAAAAAAATACACCACAGGA No data
Right 931655430 2:64507023-64507045 ATTGGTAATGGCTGAGAAGGTGG No data
931655426_931655430 10 Left 931655426 2:64506990-64507012 CCACAGGAATTTTTATGTTATCA No data
Right 931655430 2:64507023-64507045 ATTGGTAATGGCTGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931655430 Original CRISPR ATTGGTAATGGCTGAGAAGG TGG Intergenic
No off target data available for this crispr