ID: 931656662

View in Genome Browser
Species Human (GRCh38)
Location 2:64515440-64515462
Sequence AGGATTTTAAAGATGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931656662_931656664 11 Left 931656662 2:64515440-64515462 CCTTTCTACATCTTTAAAATCCT No data
Right 931656664 2:64515474-64515496 TTGTTAACAAGATCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931656662 Original CRISPR AGGATTTTAAAGATGTAGAA AGG (reversed) Intergenic
No off target data available for this crispr