ID: 931657526

View in Genome Browser
Species Human (GRCh38)
Location 2:64524106-64524128
Sequence CTTGCGAGTCATAGAGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931657526_931657534 24 Left 931657526 2:64524106-64524128 CCTACAGCTCTATGACTCGCAAG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 931657534 2:64524153-64524175 CCCGCACCCAAAATGGCGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 49
931657526_931657529 -7 Left 931657526 2:64524106-64524128 CCTACAGCTCTATGACTCGCAAG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 931657529 2:64524122-64524144 TCGCAAGGAAGTAAAAGGAAAGG 0: 1
1: 0
2: 3
3: 23
4: 526
931657526_931657532 20 Left 931657526 2:64524106-64524128 CCTACAGCTCTATGACTCGCAAG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 931657532 2:64524149-64524171 CTTGCCCGCACCCAAAATGGCGG 0: 1
1: 0
2: 1
3: 5
4: 97
931657526_931657531 17 Left 931657526 2:64524106-64524128 CCTACAGCTCTATGACTCGCAAG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 931657531 2:64524146-64524168 CAGCTTGCCCGCACCCAAAATGG 0: 1
1: 0
2: 1
3: 4
4: 86
931657526_931657530 -6 Left 931657526 2:64524106-64524128 CCTACAGCTCTATGACTCGCAAG 0: 1
1: 0
2: 1
3: 5
4: 67
Right 931657530 2:64524123-64524145 CGCAAGGAAGTAAAAGGAAAGGG 0: 1
1: 0
2: 3
3: 50
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931657526 Original CRISPR CTTGCGAGTCATAGAGCTGT AGG (reversed) Intergenic
903440376 1:23383683-23383705 CATGCAAGTCAGAGAGCAGTTGG + Intronic
904574303 1:31493222-31493244 CATGGGAGTCATAGAAATGTTGG + Intergenic
906841810 1:49147291-49147313 CTTTGGAGTCACAGAGCTCTGGG - Intronic
912020802 1:105107357-105107379 CTTAGGAGTCATGCAGCTGTAGG + Intergenic
912346670 1:108969321-108969343 TTTAGGAGTCATAGAGCTGGAGG + Intergenic
914815320 1:151058695-151058717 CTTGAGGGTCTCAGAGCTGTTGG + Exonic
915481484 1:156188923-156188945 CATGCTAGACATAGAGCTCTGGG - Intergenic
917594800 1:176518188-176518210 ATTGTGAGTCAGAGACCTGTGGG - Intronic
918838091 1:189496089-189496111 CATGTGAGTAATATAGCTGTTGG + Intergenic
922491375 1:226019557-226019579 CATGCCAGTCATAGAGGTCTGGG + Intergenic
1064954889 10:20896878-20896900 TTATAGAGTCATAGAGCTGTGGG - Intronic
1071260329 10:83913767-83913789 CTTGAGAGTCAGAGAGATGTGGG - Intergenic
1073699535 10:105910416-105910438 CTTGCCATTCATAGAACTATAGG + Intergenic
1075840163 10:125494542-125494564 CATGAGAGTGATAGAGCTCTGGG - Intergenic
1076587597 10:131559999-131560021 CTTGGGAGACACAGAGCTGAAGG - Intergenic
1079479885 11:20868223-20868245 CTTGGGAGTCATGGAGGTCTGGG - Intronic
1099641477 12:85291872-85291894 CTTTCCAGTCAGAGAGGTGTGGG + Intronic
1103645081 12:122385480-122385502 CTTGCTATTCATAGAGGTGGAGG - Intronic
1107868542 13:44726866-44726888 TTTGGGAGTCATGGAGCTGGAGG + Intergenic
1112100837 13:96187505-96187527 CTTTGGAGTCATAGAGCCCTGGG - Intronic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1119715699 14:76857556-76857578 CCTGTGAGGGATAGAGCTGTTGG - Intronic
1120408608 14:84121314-84121336 CTTGCCATTCATTGAGCTGCTGG - Intergenic
1121647504 14:95529484-95529506 CTTGAAAGTCATACACCTGTTGG - Intergenic
1123035226 14:105469255-105469277 CTTGCTGGCCAGAGAGCTGTGGG + Intronic
1133844221 16:9439195-9439217 CTTGTGAGTCATGGACCTTTGGG + Intergenic
1137714073 16:50587036-50587058 CTTTCGAGTCGTGGAGCTGATGG - Intronic
1141312859 16:82932157-82932179 CTTTTGAGTCATATAGATGTAGG + Intronic
1141683020 16:85555057-85555079 CCTGCGAAGCATGGAGCTGTTGG + Intergenic
1151421715 17:74002664-74002686 CTTCTGACTCACAGAGCTGTTGG - Intergenic
1152307001 17:79526959-79526981 CTTGTGAGTCTTCCAGCTGTAGG - Intergenic
1158421703 18:57300396-57300418 ATAGCAACTCATAGAGCTGTAGG - Intergenic
1162462035 19:10819006-10819028 CTGGCGAGTCACGGAGCTGGGGG - Intronic
929321431 2:40547925-40547947 CATGCCAGTCATAAAGCTGTAGG - Intronic
931657526 2:64524106-64524128 CTTGCGAGTCATAGAGCTGTAGG - Intergenic
932903042 2:75722100-75722122 CTTGTTAGTGATAAAGCTGTAGG - Intergenic
937990531 2:127659618-127659640 CTTGGGAGTCTTAGAGAAGTCGG + Intronic
938513432 2:131976720-131976742 CTTGGGAGTCATAGATCTTTTGG - Intergenic
939486906 2:142826029-142826051 CTTCCCAGACATAGAGCTGTGGG + Intergenic
948349038 2:237323105-237323127 CTTGCGGAGCAGAGAGCTGTGGG - Intergenic
1170446538 20:16433727-16433749 CTTGAATGTCATAGAGCTTTAGG - Intronic
1170518566 20:17158831-17158853 CTTGGGAATCATAGAGCTTATGG + Intergenic
1172268321 20:33636816-33636838 CTTGCTCCTCATAGAGCTCTAGG + Intronic
1175198983 20:57265543-57265565 CTTGGGAGTCATAGGGCTGTGGG + Intronic
1182487651 22:30648956-30648978 CTGGCGAGTCAGGGAGCTCTGGG - Intronic
954146166 3:48635381-48635403 CTTGCGAGCCATGGGGCTGGCGG - Exonic
962964143 3:140337972-140337994 CTAGGGAGTGATAGAGCTGGGGG + Intronic
964907808 3:161739531-161739553 CTTTAGATTCATAGAGTTGTAGG - Intergenic
966266743 3:178055113-178055135 CTTGGGAGTCAGAGAGATGGGGG + Intergenic
970443643 4:16106568-16106590 CTAACCAGTCATAGACCTGTAGG - Intergenic
970469365 4:16361356-16361378 CTTGCGAGACAGACAGCAGTTGG + Intergenic
971784738 4:31085355-31085377 CTTAGGAGTCATACAGCTGTAGG - Intronic
982668472 4:158293555-158293577 CATGCTAGACATAGAGCTCTGGG + Intergenic
984681848 4:182620109-182620131 CTGCCGAGTCATACAGCTCTGGG - Intronic
989907052 5:47273342-47273364 CTTTCTTTTCATAGAGCTGTTGG + Intergenic
995914619 5:117229724-117229746 ATTGCAAGTCATAGAGATATAGG - Intergenic
1001719689 5:173846835-173846857 CTAGGGAGTCACAGTGCTGTAGG - Intergenic
1002451862 5:179323332-179323354 CTTGGGAGTCCTACAGCTGGAGG - Intronic
1003810705 6:9776836-9776858 CTTTGGAGGCATAAAGCTGTAGG - Intronic
1010560200 6:77340213-77340235 CCTGCTAATCATAGAGCTCTAGG - Intergenic
1015105861 6:129535990-129536012 CTCTCCAGTCATAAAGCTGTTGG - Intergenic
1019201571 6:170320686-170320708 CTTGCCAGTAATAGAACTTTAGG - Intronic
1020957852 7:14764545-14764567 CTAGCCAGTCATGGAGATGTAGG - Intronic
1023266676 7:38413264-38413286 CTTAGGTGTCACAGAGCTGTGGG + Intronic
1032487624 7:132299906-132299928 CTTGCGGCTCAAAGATCTGTGGG + Intronic
1037312934 8:17575767-17575789 CTTGCGATGCAGAGAGCAGTTGG - Intergenic
1039699309 8:39946052-39946074 CTTAGGAGTCATACAGCTGGAGG + Intronic
1045871253 8:106929812-106929834 CTTTAGAGTCAGAGAGATGTGGG - Intergenic
1052348427 9:27433860-27433882 CTTGCGAGTCAAAGAATTCTTGG + Intronic
1060629966 9:125147361-125147383 CTTGCAAGTCATAGATTTATGGG - Exonic
1061468094 9:130799114-130799136 CAGGGGAGTCATAAAGCTGTAGG + Intronic
1061505134 9:131027436-131027458 CTTTGGAGTCATAGAGCCCTGGG + Intronic
1186093471 X:6074676-6074698 CTTGAGAGTCATAGAGAGGAAGG + Intronic
1187715845 X:22101746-22101768 CTTGTGACTCATCTAGCTGTAGG + Intronic