ID: 931661617

View in Genome Browser
Species Human (GRCh38)
Location 2:64569611-64569633
Sequence ACGTGTGTGTAGCTCTTCAC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931661617 Original CRISPR ACGTGTGTGTAGCTCTTCAC GGG Exonic
900313146 1:2044304-2044326 ATATGTGTGTAGTTCTCCACAGG - Intergenic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
906136448 1:43503300-43503322 GAGTCTGTGTAGCTCTTCTCCGG - Intergenic
920201740 1:204263680-204263702 ACGTGTCTGTGTCTCTGCACAGG + Intronic
1070308404 10:75254780-75254802 TGGGGTGTGTAGTTCTTCACTGG - Intergenic
1075934573 10:126328515-126328537 ACGTGTGTGTACCTGTTTGCAGG - Intronic
1077656447 11:4023804-4023826 ACCTGTGTGGAGATCTTGACGGG + Intronic
1082681465 11:56177035-56177057 AAGTGTGTGGAGCTTGTCACAGG + Exonic
1084794424 11:71495741-71495763 ACGTCTGTGTTGCTCACCACAGG - Intronic
1085664152 11:78398009-78398031 GTGTGTGTGTAGCTATTCACAGG - Intronic
1092944138 12:13437314-13437336 GGGTGTGTGTAGCCATTCACAGG - Intergenic
1098872671 12:75834545-75834567 ACGTGTGTTATGATCTTCACTGG - Intergenic
1105008763 12:132740243-132740265 CAGTGTGTGTAGCTGTGCACAGG - Intronic
1117705016 14:58456710-58456732 AGTTGTTTCTAGCTCTTCACAGG - Exonic
1122359120 14:101148455-101148477 ACGTGTATATAGCCCTGCACAGG + Intergenic
1123702875 15:22928608-22928630 ACTTGTGTGTTGCCCTTCCCCGG - Intronic
1132319981 15:100918916-100918938 ATGTGCGTAGAGCTCTTCACGGG - Intergenic
1139283418 16:65789064-65789086 AAGTGTGTGTAGCTCATTAACGG + Intergenic
1148861345 17:50605886-50605908 ATGTGTGTCCAGCTCTTCAAAGG + Exonic
1150038612 17:61833157-61833179 ACATGAGTGTAGCTATTCAGTGG - Intronic
1156454036 18:37282849-37282871 GGGAGTGTGTAGCTCTCCACTGG - Intronic
1162186569 19:8909744-8909766 CCCTGTTTCTAGCTCTTCACTGG - Intronic
1163790965 19:19305941-19305963 GCGTGGGAGTAGCTCTTCACAGG + Exonic
1164720179 19:30426114-30426136 ACCTGTTTGTAGCTCCTCAGGGG - Intronic
1166378168 19:42340191-42340213 AAATGTGTGGAGCACTTCACTGG - Intronic
1166963894 19:46516156-46516178 AGGTGTGTGAAGCACTTAACAGG - Intronic
1168313679 19:55474325-55474347 ACATCTGTGTAGCCCTTCAAGGG - Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
928331784 2:30363211-30363233 ACGTGTGTGTATGTGTTTACAGG + Intergenic
931661617 2:64569611-64569633 ACGTGTGTGTAGCTCTTCACGGG + Exonic
933695483 2:85214134-85214156 ATGTGGCTGTGGCTCTTCACGGG - Intronic
937460415 2:122080512-122080534 ACCTGTGTTTAGCTATTCACTGG + Intergenic
940852297 2:158700119-158700141 ACGTCTGTGTAGGTTTTCTCTGG + Intergenic
947574176 2:231259350-231259372 ACCTGTGTGTAGCCCTTTCCTGG + Intronic
1170307643 20:14957715-14957737 ACCAGTGTGTAGCACTTCTCTGG + Intronic
1171108037 20:22454695-22454717 CCTTGTGTGTAGCTCTTGTCAGG + Intergenic
1171320426 20:24239033-24239055 AAGTCTGTGTAGCTTCTCACTGG - Intergenic
949311999 3:2710267-2710289 ATGTGTGTAAAGCACTTCACAGG + Intronic
950487315 3:13281375-13281397 ACGTGTGTATAGCTCCTAACTGG - Intergenic
952538934 3:34345655-34345677 AGGTTTGTGTAGCTCTGAACAGG + Intergenic
954810884 3:53246990-53247012 ACCTGTGTGTAGCTGCTCCCAGG - Intronic
957627932 3:82678858-82678880 ATGTGTGAGTAGGTTTTCACAGG - Intergenic
970751388 4:19367440-19367462 ACATGTATGTAGTGCTTCACAGG - Intergenic
973175133 4:47196336-47196358 ACTTGGGTATAGGTCTTCACAGG + Intronic
974073692 4:57148956-57148978 AAGTGTGTGAAGCTTCTCACAGG - Intergenic
976754158 4:88480586-88480608 ATGTGTGTGTTGTTCTTTACTGG + Intronic
980961849 4:139483208-139483230 ACGCCTCTGAAGCTCTTCACTGG + Intergenic
986000790 5:3629212-3629234 AGGTGCTTGTAGCTCTTCCCAGG - Intergenic
986452791 5:7882767-7882789 ACATGTGTGTAGATGGTCACAGG - Intronic
987047575 5:14122357-14122379 ACTTGTGCTTATCTCTTCACAGG - Intergenic
989583301 5:43053602-43053624 AAGTGAGTGTAGCTCTTCTGTGG - Intergenic
997469948 5:134111972-134111994 ATGTGTGTGAAGCTCTTGACAGG + Intergenic
1000740507 5:164963631-164963653 AGGTGTGTGTATGTGTTCACAGG + Intergenic
1008052189 6:46911621-46911643 AAGTGTGTGTAGGTGTTCAGGGG - Intronic
1013045007 6:106476772-106476794 AGGTGTGTGTGGTTCTACACTGG - Intergenic
1015874186 6:137806223-137806245 ATGTATGTGTTGCTTTTCACTGG + Intergenic
1017665959 6:156720274-156720296 GCGTGTGTGTTGCTCCTGACAGG - Intergenic
1031079680 7:117246321-117246343 AAGTGAGTGTTGCTCTTCAATGG + Intergenic
1031162765 7:118188334-118188356 ACGAGTATTCAGCTCTTCACAGG + Exonic
1038251484 8:25908955-25908977 TCGTCTGTGTGGCTCTCCACTGG + Intronic
1045479646 8:102581745-102581767 ACTTGAGTGTCCCTCTTCACTGG - Intergenic
1052505384 9:29347299-29347321 AAGGGTGTGTAGCACTTCAGTGG - Intergenic
1188548112 X:31332585-31332607 ACGTGTGGGTTGCTATTCACTGG + Intronic
1196888406 X:120269190-120269212 TGGTGTGTGTAGCCCTTCAAGGG + Intronic