ID: 931665049

View in Genome Browser
Species Human (GRCh38)
Location 2:64604482-64604504
Sequence TATCCCAGCCCCATCAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931665044_931665049 3 Left 931665044 2:64604456-64604478 CCTGTGGGTCATCACTCCTACTG No data
Right 931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG No data
931665038_931665049 23 Left 931665038 2:64604436-64604458 CCCCAGCAGTGGGAACTGACCCT No data
Right 931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG No data
931665037_931665049 24 Left 931665037 2:64604435-64604457 CCCCCAGCAGTGGGAACTGACCC No data
Right 931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG No data
931665039_931665049 22 Left 931665039 2:64604437-64604459 CCCAGCAGTGGGAACTGACCCTG No data
Right 931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG No data
931665040_931665049 21 Left 931665040 2:64604438-64604460 CCAGCAGTGGGAACTGACCCTGT No data
Right 931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG No data
931665043_931665049 4 Left 931665043 2:64604455-64604477 CCCTGTGGGTCATCACTCCTACT No data
Right 931665049 2:64604482-64604504 TATCCCAGCCCCATCAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931665049 Original CRISPR TATCCCAGCCCCATCAGGAT TGG Intergenic
No off target data available for this crispr