ID: 931665850

View in Genome Browser
Species Human (GRCh38)
Location 2:64609229-64609251
Sequence GGGGCTGCCGGTGCTCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931665837_931665850 3 Left 931665837 2:64609203-64609225 CCCGGGATGCCAGGATGCGGGGG No data
Right 931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG No data
931665839_931665850 2 Left 931665839 2:64609204-64609226 CCGGGATGCCAGGATGCGGGGGG No data
Right 931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG No data
931665832_931665850 11 Left 931665832 2:64609195-64609217 CCGCCGGGCCCGGGATGCCAGGA No data
Right 931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG No data
931665828_931665850 21 Left 931665828 2:64609185-64609207 CCTGCTCTGGCCGCCGGGCCCGG No data
Right 931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG No data
931665844_931665850 -6 Left 931665844 2:64609212-64609234 CCAGGATGCGGGGGGCCGGGGCT No data
Right 931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG No data
931665833_931665850 8 Left 931665833 2:64609198-64609220 CCGGGCCCGGGATGCCAGGATGC No data
Right 931665850 2:64609229-64609251 GGGGCTGCCGGTGCTCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931665850 Original CRISPR GGGGCTGCCGGTGCTCTTGG GGG Intergenic