ID: 931667276

View in Genome Browser
Species Human (GRCh38)
Location 2:64618335-64618357
Sequence AGGAGAGAGCAGGGCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931667272_931667276 -3 Left 931667272 2:64618315-64618337 CCAGGAGGGGTCAGTGGGGCAGG No data
Right 931667276 2:64618335-64618357 AGGAGAGAGCAGGGCCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931667276 Original CRISPR AGGAGAGAGCAGGGCCTTGA AGG Intergenic
No off target data available for this crispr