ID: 931667781

View in Genome Browser
Species Human (GRCh38)
Location 2:64622743-64622765
Sequence CCCCTCCACTCCCCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931667781_931667791 27 Left 931667781 2:64622743-64622765 CCAGCCTCAGGGGAGTGGAGGGG No data
Right 931667791 2:64622793-64622815 AGGTTGCCTGTGCCTTGGCTCGG No data
931667781_931667786 7 Left 931667781 2:64622743-64622765 CCAGCCTCAGGGGAGTGGAGGGG No data
Right 931667786 2:64622773-64622795 TAGATGCTTCTCCTCCCTGCAGG No data
931667781_931667792 28 Left 931667781 2:64622743-64622765 CCAGCCTCAGGGGAGTGGAGGGG No data
Right 931667792 2:64622794-64622816 GGTTGCCTGTGCCTTGGCTCGGG No data
931667781_931667790 22 Left 931667781 2:64622743-64622765 CCAGCCTCAGGGGAGTGGAGGGG No data
Right 931667790 2:64622788-64622810 CCTGCAGGTTGCCTGTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931667781 Original CRISPR CCCCTCCACTCCCCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr