ID: 931668112

View in Genome Browser
Species Human (GRCh38)
Location 2:64624649-64624671
Sequence TTCTCAAGGCTGGCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931668112_931668120 12 Left 931668112 2:64624649-64624671 CCCCTCTGGGCCAGCCTTGAGAA No data
Right 931668120 2:64624684-64624706 TGTCTAAGCCTTCTGCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931668112 Original CRISPR TTCTCAAGGCTGGCCCAGAG GGG (reversed) Intergenic
No off target data available for this crispr