ID: 931681032

View in Genome Browser
Species Human (GRCh38)
Location 2:64750389-64750411
Sequence TACAGGACGGTGAGTTCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931681032 Original CRISPR TACAGGACGGTGAGTTCGAG GGG Intronic
916655994 1:166875976-166875998 TCCAGGGCGGTGAGTTCAGGTGG + Intronic
1067833422 10:49623188-49623210 GACAGGACGGTGAGCTGGAGGGG - Intronic
1076016541 10:127032312-127032334 CTCAGAACGGTGCGTTCGAGAGG + Exonic
1076799003 10:132812060-132812082 CACAGGACGTTGAGTCAGAGGGG + Intronic
1079859794 11:25654569-25654591 TAAAGGAAGGTGATTTCCAGGGG - Intergenic
1088546534 11:110965135-110965157 TACAGGTAGGTGAGTCCCAGTGG + Intergenic
1102645679 12:114402141-114402163 TACAGCACTGTGGGTTCAAGTGG - Intronic
1103199055 12:119071582-119071604 TAATGGAGGGTGAGTTCCAGGGG - Intronic
1111962441 13:94826050-94826072 AACAGGAGGGTGAGTTTGGGGGG + Intergenic
1160240128 18:77117752-77117774 TAGGGGACGGTGCGTTGGAGTGG + Intronic
1160338606 18:78067053-78067075 TACAGGCCGGTGATCTTGAGGGG - Intergenic
928448359 2:31353541-31353563 GACATGATGGTGAGTTCCAGGGG + Intronic
931681032 2:64750389-64750411 TACAGGACGGTGAGTTCGAGGGG + Intronic
942432456 2:175927100-175927122 TACAGGACGTTGAGAGCAAGAGG + Exonic
1168808399 20:686686-686708 TCCAGGAAGGTAAGTTCGCGGGG - Intergenic
1170542614 20:17404417-17404439 TAGAGGACGGTGACTCCTAGGGG + Intronic
1170914511 20:20609712-20609734 TCCAGGACGGGGAGCTCGAAAGG + Intronic
1172277800 20:33689757-33689779 CACTGGACTGTGAGTTCCAGGGG - Intergenic
1174127420 20:48317272-48317294 GACAGGACAGTGAGTTCCTGGGG + Intergenic
1175915267 20:62423068-62423090 AACAGGACGCTGAGCTCCAGAGG + Intronic
1181115483 22:20630457-20630479 TACAGGAGAGTGAGATGGAGTGG + Intergenic
1185239448 22:49734917-49734939 TGCAGGAGGGTGAGTGGGAGGGG - Intergenic
951463269 3:22974000-22974022 TATAGGACTGTGAGTTCGTCAGG + Intergenic
952177585 3:30882355-30882377 AACAGGATGGTGATTTCCAGTGG - Intronic
952481966 3:33770857-33770879 TACATGACGGTGAATCCTAGTGG + Intergenic
972987887 4:44787232-44787254 TACAGAAGTGTGATTTCGAGGGG + Intergenic
977564743 4:98569401-98569423 TGCAGGGCGGTGTGTTCCAGTGG - Intronic
977672585 4:99713282-99713304 TACAGGAAGATGAGTTCCAGAGG - Intergenic
997583774 5:135033178-135033200 CAGAGGACGGTGAGGGCGAGCGG - Intronic
997855469 5:137368793-137368815 CACAGGACTGTGTGTTCCAGAGG + Intronic
999445021 5:151632450-151632472 TTCAGTAGGGTGAGATCGAGAGG + Intergenic
1000275591 5:159732162-159732184 TACAGGATGGGGAGTGAGAGGGG - Intergenic
1003087377 6:3070716-3070738 TACAGGAAGGTGAGGTGCAGGGG - Intronic
1017258335 6:152359892-152359914 TAGAGGACGGAGAGCTAGAGAGG - Intronic
1021436943 7:20629227-20629249 TAGAGGCTGGTGAGTTCAAGAGG + Intronic
1022501328 7:30883883-30883905 TGCAGGAAGGTGAGGTCCAGTGG - Intronic
1023871456 7:44265031-44265053 TGCAGGACGGTGAGTTCACGGGG + Intronic
1026883543 7:73922328-73922350 GACAGGACCGTGAGGTCCAGAGG + Intergenic
1037751198 8:21683461-21683483 TGCAGGAGGGGGAGTTTGAGGGG + Intergenic
1043512459 8:80963070-80963092 TACAAGGCTGTGAGTTCCAGAGG + Intergenic
1047798533 8:128284272-128284294 TACCGGATGGTGAGATCAAGGGG + Intergenic
1048465850 8:134664212-134664234 TACAGGACGGAGGGTCAGAGAGG + Intronic
1048665720 8:136658396-136658418 TACTGGACACTGAGTTAGAGTGG - Intergenic
1054823744 9:69549582-69549604 TACAGGCCAGTGAGGCCGAGGGG - Intronic