ID: 931681576

View in Genome Browser
Species Human (GRCh38)
Location 2:64753564-64753586
Sequence GCCCCTGTGTCAGTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931681575_931681576 6 Left 931681575 2:64753535-64753557 CCTAGGGTTAGCATCTTGTGGCA No data
Right 931681576 2:64753564-64753586 GCCCCTGTGTCAGTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931681576 Original CRISPR GCCCCTGTGTCAGTTGTTAC TGG Intergenic
No off target data available for this crispr