ID: 931684422

View in Genome Browser
Species Human (GRCh38)
Location 2:64781391-64781413
Sequence CCATAACAAAAGGAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931684422_931684434 25 Left 931684422 2:64781391-64781413 CCCTGCACCTCCTTTTGTTATGG No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931684422 Original CRISPR CCATAACAAAAGGAGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr