ID: 931684434

View in Genome Browser
Species Human (GRCh38)
Location 2:64781439-64781461
Sequence TCACCTCTGCTCCAACTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931684426_931684434 15 Left 931684426 2:64781401-64781423 CCTTTTGTTATGGCCCCCATGAG No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684425_931684434 18 Left 931684425 2:64781398-64781420 CCTCCTTTTGTTATGGCCCCCAT No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684431_931684434 -10 Left 931684431 2:64781426-64781448 CCCAACTCACCTCTCACCTCTGC No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684428_931684434 1 Left 931684428 2:64781415-64781437 CCCCATGAGTACCCAACTCACCT No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684430_931684434 -1 Left 931684430 2:64781417-64781439 CCATGAGTACCCAACTCACCTCT No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684424_931684434 24 Left 931684424 2:64781392-64781414 CCTGCACCTCCTTTTGTTATGGC No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684422_931684434 25 Left 931684422 2:64781391-64781413 CCCTGCACCTCCTTTTGTTATGG No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684427_931684434 2 Left 931684427 2:64781414-64781436 CCCCCATGAGTACCCAACTCACC No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684421_931684434 26 Left 931684421 2:64781390-64781412 CCCCTGCACCTCCTTTTGTTATG No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684429_931684434 0 Left 931684429 2:64781416-64781438 CCCATGAGTACCCAACTCACCTC No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data
931684420_931684434 30 Left 931684420 2:64781386-64781408 CCGGCCCCTGCACCTCCTTTTGT No data
Right 931684434 2:64781439-64781461 TCACCTCTGCTCCAACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931684434 Original CRISPR TCACCTCTGCTCCAACTTCT TGG Intergenic
No off target data available for this crispr