ID: 931686160

View in Genome Browser
Species Human (GRCh38)
Location 2:64795975-64795997
Sequence TGGATGAAATGCCACACCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931686160_931686166 2 Left 931686160 2:64795975-64795997 CCTGCGGTGTGGCATTTCATCCA No data
Right 931686166 2:64796000-64796022 CCTGGAAGTGGAAGTGCAGGTGG No data
931686160_931686162 -10 Left 931686160 2:64795975-64795997 CCTGCGGTGTGGCATTTCATCCA No data
Right 931686162 2:64795988-64796010 ATTTCATCCAAACCTGGAAGTGG No data
931686160_931686167 27 Left 931686160 2:64795975-64795997 CCTGCGGTGTGGCATTTCATCCA No data
Right 931686167 2:64796025-64796047 GACCAGCCAATAGAGAAAAAAGG No data
931686160_931686164 -1 Left 931686160 2:64795975-64795997 CCTGCGGTGTGGCATTTCATCCA No data
Right 931686164 2:64795997-64796019 AAACCTGGAAGTGGAAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931686160 Original CRISPR TGGATGAAATGCCACACCGC AGG (reversed) Intergenic
No off target data available for this crispr