ID: 931694986

View in Genome Browser
Species Human (GRCh38)
Location 2:64864986-64865008
Sequence TCTCCGGGGTGGGGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931694986_931694997 -3 Left 931694986 2:64864986-64865008 CCCCCAGGACCCCACCCCGGAGA No data
Right 931694997 2:64865006-64865028 AGACCTCCCAGCAGTCAAATGGG No data
931694986_931695001 5 Left 931694986 2:64864986-64865008 CCCCCAGGACCCCACCCCGGAGA No data
Right 931695001 2:64865014-64865036 CAGCAGTCAAATGGGCCTTGAGG No data
931694986_931694996 -4 Left 931694986 2:64864986-64865008 CCCCCAGGACCCCACCCCGGAGA No data
Right 931694996 2:64865005-64865027 GAGACCTCCCAGCAGTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931694986 Original CRISPR TCTCCGGGGTGGGGTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr