ID: 931695653

View in Genome Browser
Species Human (GRCh38)
Location 2:64868730-64868752
Sequence TCCTCCTTCCCTCATTTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695653_931695659 9 Left 931695653 2:64868730-64868752 CCACGGAAATGAGGGAAGGAGGA No data
Right 931695659 2:64868762-64868784 GCACCTGAGGACTGAGAGTGGGG No data
931695653_931695658 8 Left 931695653 2:64868730-64868752 CCACGGAAATGAGGGAAGGAGGA No data
Right 931695658 2:64868761-64868783 TGCACCTGAGGACTGAGAGTGGG No data
931695653_931695657 7 Left 931695653 2:64868730-64868752 CCACGGAAATGAGGGAAGGAGGA No data
Right 931695657 2:64868760-64868782 CTGCACCTGAGGACTGAGAGTGG No data
931695653_931695656 -4 Left 931695653 2:64868730-64868752 CCACGGAAATGAGGGAAGGAGGA No data
Right 931695656 2:64868749-64868771 AGGAAGGGAAGCTGCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695653 Original CRISPR TCCTCCTTCCCTCATTTCCG TGG (reversed) Intergenic
No off target data available for this crispr