ID: 931695778

View in Genome Browser
Species Human (GRCh38)
Location 2:64869540-64869562
Sequence GTCTTGGGGGTATGTGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695778_931695791 20 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695778_931695786 4 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695786 2:64869567-64869589 TCAGAAGGATGGTAGAAAAGTGG No data
931695778_931695792 29 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695792 2:64869592-64869614 AGAAGGCAAGTGGGTGAATGCGG No data
931695778_931695789 12 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695778_931695787 5 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695787 2:64869568-64869590 CAGAAGGATGGTAGAAAAGTGGG No data
931695778_931695788 6 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695788 2:64869569-64869591 AGAAGGATGGTAGAAAAGTGGGG No data
931695778_931695793 30 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695793 2:64869593-64869615 GAAGGCAAGTGGGTGAATGCGGG No data
931695778_931695784 -7 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695784 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
931695778_931695790 19 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695790 2:64869582-64869604 AAAAGTGGGGAGAAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695778 Original CRISPR GTCTTGGGGGTATGTGCTTG TGG (reversed) Intergenic