ID: 931695783

View in Genome Browser
Species Human (GRCh38)
Location 2:64869556-64869578
Sequence CCATCCTTCTGATTTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695783_931695790 3 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695790 2:64869582-64869604 AAAAGTGGGGAGAAGGCAAGTGG No data
931695783_931695788 -10 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695788 2:64869569-64869591 AGAAGGATGGTAGAAAAGTGGGG No data
931695783_931695792 13 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695792 2:64869592-64869614 AGAAGGCAAGTGGGTGAATGCGG No data
931695783_931695794 23 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data
931695783_931695789 -4 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695783_931695791 4 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695783_931695793 14 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695793 2:64869593-64869615 GAAGGCAAGTGGGTGAATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695783 Original CRISPR CCATCCTTCTGATTTGGTCT TGG (reversed) Intergenic
No off target data available for this crispr