ID: 931695785

View in Genome Browser
Species Human (GRCh38)
Location 2:64869562-64869584
Sequence TTTCTACCATCCTTCTGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695785_931695789 -10 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695785_931695792 7 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695792 2:64869592-64869614 AGAAGGCAAGTGGGTGAATGCGG No data
931695785_931695794 17 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data
931695785_931695791 -2 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695785_931695793 8 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695793 2:64869593-64869615 GAAGGCAAGTGGGTGAATGCGGG No data
931695785_931695790 -3 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695790 2:64869582-64869604 AAAAGTGGGGAGAAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695785 Original CRISPR TTTCTACCATCCTTCTGATT TGG (reversed) Intergenic