ID: 931695789

View in Genome Browser
Species Human (GRCh38)
Location 2:64869575-64869597
Sequence ATGGTAGAAAAGTGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695781_931695789 -2 Left 931695781 2:64869554-64869576 CCCCAAGACCAAATCAGAAGGAT No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695778_931695789 12 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695780_931695789 -1 Left 931695780 2:64869553-64869575 CCCCCAAGACCAAATCAGAAGGA No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695785_931695789 -10 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695783_931695789 -4 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data
931695782_931695789 -3 Left 931695782 2:64869555-64869577 CCCAAGACCAAATCAGAAGGATG No data
Right 931695789 2:64869575-64869597 ATGGTAGAAAAGTGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695789 Original CRISPR ATGGTAGAAAAGTGGGGAGA AGG Intergenic