ID: 931695791

View in Genome Browser
Species Human (GRCh38)
Location 2:64869583-64869605
Sequence AAAGTGGGGAGAAGGCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695783_931695791 4 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695778_931695791 20 Left 931695778 2:64869540-64869562 CCACAAGCACATACCCCCAAGAC No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695780_931695791 7 Left 931695780 2:64869553-64869575 CCCCCAAGACCAAATCAGAAGGA No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695781_931695791 6 Left 931695781 2:64869554-64869576 CCCCAAGACCAAATCAGAAGGAT No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695785_931695791 -2 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data
931695782_931695791 5 Left 931695782 2:64869555-64869577 CCCAAGACCAAATCAGAAGGATG No data
Right 931695791 2:64869583-64869605 AAAGTGGGGAGAAGGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695791 Original CRISPR AAAGTGGGGAGAAGGCAAGT GGG Intergenic