ID: 931695794

View in Genome Browser
Species Human (GRCh38)
Location 2:64869602-64869624
Sequence TGGGTGAATGCGGGCCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931695783_931695794 23 Left 931695783 2:64869556-64869578 CCAAGACCAAATCAGAAGGATGG No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data
931695782_931695794 24 Left 931695782 2:64869555-64869577 CCCAAGACCAAATCAGAAGGATG No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data
931695785_931695794 17 Left 931695785 2:64869562-64869584 CCAAATCAGAAGGATGGTAGAAA No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data
931695781_931695794 25 Left 931695781 2:64869554-64869576 CCCCAAGACCAAATCAGAAGGAT No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data
931695780_931695794 26 Left 931695780 2:64869553-64869575 CCCCCAAGACCAAATCAGAAGGA No data
Right 931695794 2:64869602-64869624 TGGGTGAATGCGGGCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931695794 Original CRISPR TGGGTGAATGCGGGCCACAG TGG Intergenic