ID: 931697025

View in Genome Browser
Species Human (GRCh38)
Location 2:64879023-64879045
Sequence CACCAGAGGCAGAGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931697018_931697025 -6 Left 931697018 2:64879006-64879028 CCGAAGAACCCATTTCCCACCAG No data
Right 931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG No data
931697017_931697025 -5 Left 931697017 2:64879005-64879027 CCCGAAGAACCCATTTCCCACCA No data
Right 931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931697025 Original CRISPR CACCAGAGGCAGAGCATGGA AGG Intergenic
No off target data available for this crispr