ID: 931697220

View in Genome Browser
Species Human (GRCh38)
Location 2:64880307-64880329
Sequence TGGCCTAATGGATCCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931697209_931697220 21 Left 931697209 2:64880263-64880285 CCCCAACTTGAGTCTCCAATCTC No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697211_931697220 19 Left 931697211 2:64880265-64880287 CCAACTTGAGTCTCCAATCTCGC No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697210_931697220 20 Left 931697210 2:64880264-64880286 CCCAACTTGAGTCTCCAATCTCG No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697207_931697220 27 Left 931697207 2:64880257-64880279 CCGCCACCCCAACTTGAGTCTCC No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697212_931697220 6 Left 931697212 2:64880278-64880300 CCAATCTCGCCACCGTGATCTGG No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697208_931697220 24 Left 931697208 2:64880260-64880282 CCACCCCAACTTGAGTCTCCAAT No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697217_931697220 -6 Left 931697217 2:64880290-64880312 CCGTGATCTGGGCAGCCTGGCCT No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data
931697215_931697220 -3 Left 931697215 2:64880287-64880309 CCACCGTGATCTGGGCAGCCTGG No data
Right 931697220 2:64880307-64880329 TGGCCTAATGGATCCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931697220 Original CRISPR TGGCCTAATGGATCCCCAGC AGG Intergenic
No off target data available for this crispr