ID: 931697237

View in Genome Browser
Species Human (GRCh38)
Location 2:64880384-64880406
Sequence CTGCCAGGAGGGAGGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931697230_931697237 7 Left 931697230 2:64880354-64880376 CCTGTGTGCCGATGCTGCTGCTT No data
Right 931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG No data
931697229_931697237 30 Left 931697229 2:64880331-64880353 CCAGGGTGAGAGGCTGTGTGTTT No data
Right 931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG No data
931697231_931697237 -1 Left 931697231 2:64880362-64880384 CCGATGCTGCTGCTTCAGCCTGC No data
Right 931697237 2:64880384-64880406 CTGCCAGGAGGGAGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931697237 Original CRISPR CTGCCAGGAGGGAGGAAGAA AGG Intergenic
No off target data available for this crispr