ID: 931698380

View in Genome Browser
Species Human (GRCh38)
Location 2:64889215-64889237
Sequence AAAGTCCTGTTGAACTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931698380_931698386 8 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698386 2:64889246-64889268 ATAAAGCCCCATGCACTTGGAGG No data
931698380_931698391 18 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG No data
931698380_931698387 9 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698387 2:64889247-64889269 TAAAGCCCCATGCACTTGGAGGG No data
931698380_931698385 5 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698385 2:64889243-64889265 TATATAAAGCCCCATGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931698380 Original CRISPR AAAGTCCTGTTGAACTCTGG GGG (reversed) Intergenic
No off target data available for this crispr