ID: 931698385

View in Genome Browser
Species Human (GRCh38)
Location 2:64889243-64889265
Sequence TATATAAAGCCCCATGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931698383_931698385 2 Left 931698383 2:64889218-64889240 CCAGAGTTCAACAGGACTTTTCC No data
Right 931698385 2:64889243-64889265 TATATAAAGCCCCATGCACTTGG No data
931698381_931698385 4 Left 931698381 2:64889216-64889238 CCCCAGAGTTCAACAGGACTTTT No data
Right 931698385 2:64889243-64889265 TATATAAAGCCCCATGCACTTGG No data
931698382_931698385 3 Left 931698382 2:64889217-64889239 CCCAGAGTTCAACAGGACTTTTC No data
Right 931698385 2:64889243-64889265 TATATAAAGCCCCATGCACTTGG No data
931698380_931698385 5 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698385 2:64889243-64889265 TATATAAAGCCCCATGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931698385 Original CRISPR TATATAAAGCCCCATGCACT TGG Intergenic
No off target data available for this crispr