ID: 931698387

View in Genome Browser
Species Human (GRCh38)
Location 2:64889247-64889269
Sequence TAAAGCCCCATGCACTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931698383_931698387 6 Left 931698383 2:64889218-64889240 CCAGAGTTCAACAGGACTTTTCC No data
Right 931698387 2:64889247-64889269 TAAAGCCCCATGCACTTGGAGGG No data
931698381_931698387 8 Left 931698381 2:64889216-64889238 CCCCAGAGTTCAACAGGACTTTT No data
Right 931698387 2:64889247-64889269 TAAAGCCCCATGCACTTGGAGGG No data
931698380_931698387 9 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698387 2:64889247-64889269 TAAAGCCCCATGCACTTGGAGGG No data
931698382_931698387 7 Left 931698382 2:64889217-64889239 CCCAGAGTTCAACAGGACTTTTC No data
Right 931698387 2:64889247-64889269 TAAAGCCCCATGCACTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931698387 Original CRISPR TAAAGCCCCATGCACTTGGA GGG Intergenic
No off target data available for this crispr