ID: 931698391

View in Genome Browser
Species Human (GRCh38)
Location 2:64889256-64889278
Sequence ATGCACTTGGAGGGTTAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931698382_931698391 16 Left 931698382 2:64889217-64889239 CCCAGAGTTCAACAGGACTTTTC No data
Right 931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG No data
931698380_931698391 18 Left 931698380 2:64889215-64889237 CCCCCAGAGTTCAACAGGACTTT No data
Right 931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG No data
931698381_931698391 17 Left 931698381 2:64889216-64889238 CCCCAGAGTTCAACAGGACTTTT No data
Right 931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG No data
931698383_931698391 15 Left 931698383 2:64889218-64889240 CCAGAGTTCAACAGGACTTTTCC No data
Right 931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG No data
931698384_931698391 -6 Left 931698384 2:64889239-64889261 CCTTTATATAAAGCCCCATGCAC No data
Right 931698391 2:64889256-64889278 ATGCACTTGGAGGGTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931698391 Original CRISPR ATGCACTTGGAGGGTTAAGA AGG Intergenic
No off target data available for this crispr