ID: 931701773

View in Genome Browser
Species Human (GRCh38)
Location 2:64914888-64914910
Sequence AAACTCGCCCTGTTACAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931701773_931701777 9 Left 931701773 2:64914888-64914910 CCACTCTGTAACAGGGCGAGTTT No data
Right 931701777 2:64914920-64914942 ATAGAATACAGCAGAAGTGAAGG No data
931701773_931701778 29 Left 931701773 2:64914888-64914910 CCACTCTGTAACAGGGCGAGTTT No data
Right 931701778 2:64914940-64914962 AGGTTCGTCACTCCCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931701773 Original CRISPR AAACTCGCCCTGTTACAGAG TGG (reversed) Intergenic
No off target data available for this crispr