ID: 931704237

View in Genome Browser
Species Human (GRCh38)
Location 2:64934008-64934030
Sequence AGTGGCATACACACAGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931704237_931704250 30 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704250 2:64934061-64934083 GAGAGCAGGCTGGATGTTGTAGG No data
931704237_931704247 16 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704247 2:64934047-64934069 TGCTGGTCAACCAGGAGAGCAGG No data
931704237_931704239 -10 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704239 2:64934021-64934043 GTATGCCACTAACCTTTCCCAGG No data
931704237_931704248 20 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704248 2:64934051-64934073 GGTCAACCAGGAGAGCAGGCTGG No data
931704237_931704242 -1 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704242 2:64934030-64934052 TAACCTTTCCCAGGGAGTGCTGG No data
931704237_931704246 8 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704246 2:64934039-64934061 CCAGGGAGTGCTGGTCAACCAGG No data
931704237_931704240 -9 Left 931704237 2:64934008-64934030 CCCAGGGCTGTGTGTATGCCACT No data
Right 931704240 2:64934022-64934044 TATGCCACTAACCTTTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931704237 Original CRISPR AGTGGCATACACACAGCCCT GGG (reversed) Intergenic
No off target data available for this crispr